Transcript: Mouse NM_025285.2

Mus musculus stathmin-like 2 (Stmn2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Stmn2 (20257)
Length:
1904
CDS:
86..625

Additional Resources:

NCBI RefSeq record:
NM_025285.2
NBCI Gene record:
Stmn2 (20257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025285.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443793 GACCTAGATGACTCCGTAATC pLKO_005 1071 3UTR 100% 10.800 15.120 N Stmn2 n/a
2 TRCN0000414125 GGATCATGCGATATCAGTATG pLKO_005 684 3UTR 100% 10.800 15.120 N Stmn2 n/a
3 TRCN0000175361 CCTGTAGTACAAGCACATAAT pLKO.1 1508 3UTR 100% 13.200 9.240 N Stmn2 n/a
4 TRCN0000434244 GAAGTGTATGACATGGTTTAA pLKO_005 706 3UTR 100% 13.200 9.240 N Stmn2 n/a
5 TRCN0000175947 GCTAATCTAGCTGCTATCATT pLKO.1 527 CDS 100% 5.625 3.938 N Stmn2 n/a
6 TRCN0000140826 GTGAGGCTAATCTAGCTGCTA pLKO.1 522 CDS 100% 2.640 1.848 N STMN2 n/a
7 TRCN0000173677 CCAAAGAAGAAAGACCTGTCT pLKO.1 305 CDS 100% 2.640 1.584 N Stmn2 n/a
8 TRCN0000144793 GAACAACAACTTCAGCAAGAT pLKO.1 454 CDS 100% 4.950 2.475 Y STMN2 n/a
9 TRCN0000141738 GAGGCTAATCTAGCTGCTATT pLKO.1 524 CDS 100% 10.800 7.560 N STMN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025285.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02613 pDONR223 100% 92.7% 100% None (many diffs) n/a
2 ccsbBroad304_02613 pLX_304 0% 92.7% 100% V5 (many diffs) n/a
3 TRCN0000466639 ATGACTTGCGCGCAGGGGCCATTC pLX_317 55.1% 92.7% 100% V5 (many diffs) n/a
Download CSV