Transcript: Mouse NM_025369.3

Mus musculus mitochondrial ribosomal protein S36 (Mrps36), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mrps36 (66128)
Length:
716
CDS:
92..400

Additional Resources:

NCBI RefSeq record:
NM_025369.3
NBCI Gene record:
Mrps36 (66128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375153 ACCAGACACTGCAGAAATTAT pLKO_005 298 CDS 100% 15.000 10.500 N Mrps36 n/a
2 TRCN0000200744 GCAATTTCACAGCATTCTAAA pLKO.1 239 CDS 100% 13.200 9.240 N Mrps36 n/a
3 TRCN0000200569 CAGAAGGGTTAGCTTTACAAT pLKO.1 428 3UTR 100% 5.625 3.938 N Mrps36 n/a
4 TRCN0000190856 CCAGACAGAAGGGTTAGCTTT pLKO.1 423 3UTR 100% 4.950 3.465 N Mrps36 n/a
5 TRCN0000328900 CCAGACAGAAGGGTTAGCTTT pLKO_005 423 3UTR 100% 4.950 3.465 N Mrps36 n/a
6 TRCN0000190412 CCTAAACTCAGTGCCTCAGAA pLKO.1 182 CDS 100% 4.950 3.465 N Mrps36 n/a
7 TRCN0000328899 CCTAAACTCAGTGCCTCAGAA pLKO_005 182 CDS 100% 4.950 3.465 N Mrps36 n/a
8 TRCN0000375228 ACAGAAGGAAACCTATGTCTC pLKO_005 339 CDS 100% 4.050 2.835 N Mrps36 n/a
9 TRCN0000328972 GTGAAGCCACACGCTCCATTA pLKO_005 134 CDS 100% 10.800 6.480 N Mrps36 n/a
10 TRCN0000191370 CACAGCATTCTAAAGGAAGTA pLKO.1 246 CDS 100% 4.950 2.475 Y Mrps36 n/a
11 TRCN0000191675 GAAATGGAATTTATCCAGCGT pLKO.1 365 CDS 100% 0.660 0.330 Y Mrps36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04573 pDONR223 100% 84.7% 83.4% None (many diffs) n/a
2 ccsbBroad304_04573 pLX_304 0% 84.7% 83.4% V5 (many diffs) n/a
3 TRCN0000465904 AGTACCGCGTCTGTCCTGGATTCA pLX_317 100% 84.7% 83.4% V5 (many diffs) n/a
Download CSV