Transcript: Mouse NM_025379.2

Mus musculus cytochrome c oxidase subunit VIIb (Cox7b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cox7b (66142)
Length:
1176
CDS:
132..374

Additional Resources:

NCBI RefSeq record:
NM_025379.2
NBCI Gene record:
Cox7b (66142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025379.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340144 TCGTGCCAGCTGGTACAATAA pLKO_005 375 CDS 100% 13.200 18.480 N Cox7b n/a
2 TRCN0000046325 CGTCTCCAAGTTCGAAGCATT pLKO.1 162 CDS 100% 4.950 6.930 N COX7B n/a
3 TRCN0000076536 ACAGCCACACAAATTGGAATA pLKO.1 297 CDS 100% 10.800 7.560 N Cox7b n/a
4 TRCN0000327562 ACAGCCACACAAATTGGAATA pLKO_005 297 CDS 100% 10.800 7.560 N Cox7b n/a
5 TRCN0000076535 CCACACAAATTGGAATAGAAT pLKO.1 301 CDS 100% 5.625 3.938 N Cox7b n/a
6 TRCN0000076533 CTGTGTTTCTACATGGACATA pLKO.1 275 CDS 100% 4.950 3.465 N Cox7b n/a
7 TRCN0000076537 GCACCTAGTTTCCATGACAAA pLKO.1 219 CDS 100% 4.950 3.465 N Cox7b n/a
8 TRCN0000327490 GCACCTAGTTTCCATGACAAA pLKO_005 219 CDS 100% 4.950 3.465 N Cox7b n/a
9 TRCN0000076534 TCTGTGTTTCTACATGGACAT pLKO.1 274 CDS 100% 4.050 2.430 N Cox7b n/a
10 TRCN0000327488 TCTGTGTTTCTACATGGACAT pLKO_005 274 CDS 100% 4.050 2.430 N Cox7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025379.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06022 pDONR223 100% 85.4% 78.7% None (many diffs) n/a
2 ccsbBroad304_06022 pLX_304 0% 85.4% 78.7% V5 (many diffs) n/a
3 TRCN0000481649 ATGATTGCGGCAATGCGTCGCGCA pLX_317 100% 85.4% 78.7% V5 (many diffs) n/a
Download CSV