Transcript: Mouse NM_025421.2

Mus musculus acylphosphatase 1, erythrocyte (common) type (Acyp1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Acyp1 (66204)
Length:
677
CDS:
135..434

Additional Resources:

NCBI RefSeq record:
NM_025421.2
NBCI Gene record:
Acyp1 (66204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025421.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294755 GAAGTCCCAAGTCGCACATTG pLKO_005 343 CDS 100% 10.800 15.120 N Acyp1 n/a
2 TRCN0000080886 TGGATTATTCAGACTTCCAAA pLKO.1 403 CDS 100% 4.950 3.960 N Acyp1 n/a
3 TRCN0000080884 GTCATCGCAAACTTGGATTAT pLKO.1 390 CDS 100% 13.200 9.240 N Acyp1 n/a
4 TRCN0000287190 GTCATCGCAAACTTGGATTAT pLKO_005 390 CDS 100% 13.200 9.240 N Acyp1 n/a
5 TRCN0000294754 GAACTATTCTGTGCTCAGTAT pLKO_005 507 3UTR 100% 4.950 3.465 N Acyp1 n/a
6 TRCN0000080883 GCAAACTTCAACAATGAGAAA pLKO.1 369 CDS 100% 4.950 3.465 N Acyp1 n/a
7 TRCN0000287189 GCAAACTTCAACAATGAGAAA pLKO_005 369 CDS 100% 4.950 3.465 N Acyp1 n/a
8 TRCN0000080887 CCGCAAGTACACTCAGGCTGA pLKO.1 203 CDS 100% 0.720 0.504 N Acyp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025421.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00021 pDONR223 100% 85.9% 90.9% None (many diffs) n/a
2 ccsbBroad304_00021 pLX_304 0% 85.9% 90.9% V5 (many diffs) n/a
3 TRCN0000468816 AGCCAGTCACCCTGAGGCTAACGC pLX_317 100% 85.9% 90.9% V5 (many diffs) n/a
4 TRCN0000488485 GTTCCTGCCATCGTCTCGCAAGAG pLX_317 100% 85.9% 90.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491344 AATCGTATTCCGTGCACCCGACTG pLX_317 100% 85.6% 90% V5 (many diffs) n/a
Download CSV