Transcript: Mouse NM_025462.2

Mus musculus endothelin converting enzyme 2 (Ece2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ece2 (107522)
Length:
1000
CDS:
25..792

Additional Resources:

NCBI RefSeq record:
NM_025462.2
NBCI Gene record:
Ece2 (107522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097487 CACTATGCTCAATCCCGTTAT pLKO.1 577 CDS 100% 10.800 15.120 N Ece2 n/a
2 TRCN0000097486 GACACTATGCTCAATCCCGTT pLKO.1 575 CDS 100% 2.160 1.728 N Ece2 n/a
3 TRCN0000097488 AGTGTGGATTACTCTCCAGTA pLKO.1 280 CDS 100% 4.050 2.835 N Ece2 n/a
4 TRCN0000097485 GCAGCCATGCAAGTTCGCTAT pLKO.1 307 CDS 100% 4.050 2.835 N Ece2 n/a
5 TRCN0000097484 CCTTTGTGCATTAGGCTCCTA pLKO.1 824 3UTR 100% 2.640 1.848 N Ece2 n/a
6 TRCN0000157876 CTTCCCTAATGTGACCAGTGT pLKO.1 264 CDS 100% 2.640 1.584 N ECE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07473 pDONR223 100% 85.3% 83.9% None (many diffs) n/a
2 ccsbBroad304_07473 pLX_304 0% 85.3% 83.9% V5 (many diffs) n/a
3 TRCN0000481413 CTAGACGACTTGACTGCAGTCGAC pLX_317 22.8% 85.3% 83.9% V5 (many diffs) n/a
4 TRCN0000488998 GATTCCACCCGGTGTCTGGGTCAA pLX_317 46.9% 85.3% 83.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV