Transcript: Mouse NM_025478.3

Mus musculus isochorismatase domain containing 1 (Isoc1), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Isoc1 (66307)
Length:
2563
CDS:
11..904

Additional Resources:

NCBI RefSeq record:
NM_025478.3
NBCI Gene record:
Isoc1 (66307)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098979 GTCGTGTTGTTTGGAGTAGAA pLKO.1 620 CDS 100% 4.950 6.930 N Isoc1 n/a
2 TRCN0000334861 GTCGTGTTGTTTGGAGTAGAA pLKO_005 620 CDS 100% 4.950 6.930 N Isoc1 n/a
3 TRCN0000098976 CCGTTCAAGAAATCGACTTAA pLKO.1 507 CDS 100% 13.200 10.560 N Isoc1 n/a
4 TRCN0000334781 CCGTTCAAGAAATCGACTTAA pLKO_005 507 CDS 100% 13.200 10.560 N Isoc1 n/a
5 TRCN0000098977 CCACCCGAAGTTCAAGGAAAT pLKO.1 829 CDS 100% 10.800 7.560 N Isoc1 n/a
6 TRCN0000334862 CCACCCGAAGTTCAAGGAAAT pLKO_005 829 CDS 100% 10.800 7.560 N Isoc1 n/a
7 TRCN0000098978 CGTCCAGCCATCAAATACTTT pLKO.1 386 CDS 100% 5.625 3.938 N Isoc1 n/a
8 TRCN0000334780 CGTCCAGCCATCAAATACTTT pLKO_005 386 CDS 100% 5.625 3.938 N Isoc1 n/a
9 TRCN0000098975 GCCTAGAAGATGAGTCCAGAA pLKO.1 2417 3UTR 100% 4.050 2.025 Y Isoc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11935 pDONR223 100% 69.6% 77.7% None (many diffs) n/a
2 ccsbBroad304_11935 pLX_304 0% 69.6% 77.7% V5 (many diffs) n/a
3 TRCN0000475151 TAAGCCTATCACCCTCATACCAAG pLX_317 57.5% 69.6% 77.7% V5 (many diffs) n/a
4 ccsbBroadEn_11934 pDONR223 100% 69.5% 77.7% None (many diffs) n/a
5 ccsbBroad304_11934 pLX_304 0% 69.5% 77.7% V5 (many diffs) n/a
6 TRCN0000469611 TTGACTCCTTATGGGCAATCTTTC pLX_317 58.3% 69.5% 77.7% V5 (many diffs) n/a
Download CSV