Transcript: Mouse NM_025827.3

Mus musculus lon peptidase 2, peroxisomal (Lonp2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lonp2 (66887)
Length:
2936
CDS:
141..2699

Additional Resources:

NCBI RefSeq record:
NM_025827.3
NBCI Gene record:
Lonp2 (66887)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025827.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220517 CCATAACTTCACAGATCACTA pLKO.1 1544 CDS 100% 4.950 6.930 N Lonp2 n/a
2 TRCN0000308573 CCATAACTTCACAGATCACTA pLKO_005 1544 CDS 100% 4.950 6.930 N Lonp2 n/a
3 TRCN0000220514 CCTCAGTCAATGCCTGAATAT pLKO.1 1041 CDS 100% 13.200 9.240 N Lonp2 n/a
4 TRCN0000308574 CCTCAGTCAATGCCTGAATAT pLKO_005 1041 CDS 100% 13.200 9.240 N Lonp2 n/a
5 TRCN0000220515 GCAGGACTGAAGCAGATCATA pLKO.1 2517 CDS 100% 5.625 3.938 N Lonp2 n/a
6 TRCN0000308492 GCAGGACTGAAGCAGATCATA pLKO_005 2517 CDS 100% 5.625 3.938 N Lonp2 n/a
7 TRCN0000220518 GATCGGTTCAAGATGACCATA pLKO.1 765 CDS 100% 4.950 3.465 N Lonp2 n/a
8 TRCN0000308493 GATCGGTTCAAGATGACCATA pLKO_005 765 CDS 100% 4.950 3.465 N Lonp2 n/a
9 TRCN0000220516 GCAAGTAGAATGGACGGTGAA pLKO.1 2160 CDS 100% 4.050 2.835 N Lonp2 n/a
10 TRCN0000092942 GAAGATGAGGAGGAGGAAGAA pLKO.1 915 CDS 100% 4.950 2.475 Y Gm13232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025827.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09113 pDONR223 100% 88.2% 95.4% None (many diffs) n/a
2 ccsbBroad304_09113 pLX_304 0% 88.2% 95.4% V5 (many diffs) n/a
3 TRCN0000476793 CATAAACACCTAATGTCAAGTTCT pLX_317 14.1% 88.2% 95.4% V5 (many diffs) n/a
Download CSV