Transcript: Mouse NM_025899.2

Mus musculus ubiquinol cytochrome c reductase core protein 2 (Uqcrc2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Uqcrc2 (67003)
Length:
1882
CDS:
102..1463

Additional Resources:

NCBI RefSeq record:
NM_025899.2
NBCI Gene record:
Uqcrc2 (67003)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031706 GCATCTAGTTTGACTACCAAA pLKO.1 357 CDS 100% 4.950 6.930 N Uqcrc2 n/a
2 TRCN0000324871 GCATCTAGTTTGACTACCAAA pLKO_005 357 CDS 100% 4.950 6.930 N Uqcrc2 n/a
3 TRCN0000031707 CCACTTCACAAGTGCAAGAAT pLKO.1 734 CDS 100% 5.625 3.938 N Uqcrc2 n/a
4 TRCN0000324785 CCACTTCACAAGTGCAAGAAT pLKO_005 734 CDS 100% 5.625 3.938 N Uqcrc2 n/a
5 TRCN0000031708 CGAGTGGAAACTTGGGACATA pLKO.1 1420 CDS 100% 4.950 3.465 N Uqcrc2 n/a
6 TRCN0000324783 CGAGTGGAAACTTGGGACATA pLKO_005 1420 CDS 100% 4.950 3.465 N Uqcrc2 n/a
7 TRCN0000031705 GCTGCCTACAACCAAGTCAAA pLKO.1 1158 CDS 100% 4.950 3.465 N Uqcrc2 n/a
8 TRCN0000324870 GCTGCCTACAACCAAGTCAAA pLKO_005 1158 CDS 100% 4.950 3.465 N Uqcrc2 n/a
9 TRCN0000031704 GTGTATTTAAAGCTCAGCCCA pLKO.1 1471 3UTR 100% 0.660 0.462 N Uqcrc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01757 pDONR223 100% 86% 85.6% None (many diffs) n/a
2 ccsbBroad304_01757 pLX_304 0% 86% 85.6% V5 (many diffs) n/a
3 TRCN0000470338 GTGCGCGTGGTAGTGGACAGCGAC pLX_317 34.9% 86% 85.6% V5 (many diffs) n/a
Download CSV