Transcript: Mouse NM_025921.3

Mus musculus RIKEN cDNA 2610002M06 gene (2610002M06Rik), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
2610002M06Rik (67028)
Length:
5842
CDS:
185..784

Additional Resources:

NCBI RefSeq record:
NM_025921.3
NBCI Gene record:
2610002M06Rik (67028)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100765 CGCAAATATTAGAGCAAACAT pLKO.1 1084 3UTR 100% 5.625 4.500 N 2610002M06Rik n/a
2 TRCN0000332052 CGCAAATATTAGAGCAAACAT pLKO_005 1084 3UTR 100% 5.625 4.500 N 2610002M06Rik n/a
3 TRCN0000100769 TGCTACATTGAGGAGTATGAA pLKO.1 484 CDS 100% 5.625 4.500 N 2610002M06Rik n/a
4 TRCN0000332053 TGCTACATTGAGGAGTATGAA pLKO_005 484 CDS 100% 5.625 4.500 N 2610002M06Rik n/a
5 TRCN0000100766 GCCAAGAAGTGTGATAAAGAA pLKO.1 248 CDS 100% 5.625 3.938 N 2610002M06Rik n/a
6 TRCN0000332126 GCCAAGAAGTGTGATAAAGAA pLKO_005 248 CDS 100% 5.625 3.938 N 2610002M06Rik n/a
7 TRCN0000100768 GCAATACAGAAGTTGCAAGAA pLKO.1 312 CDS 100% 4.950 3.465 N 2610002M06Rik n/a
8 TRCN0000332128 GCAATACAGAAGTTGCAAGAA pLKO_005 312 CDS 100% 4.950 3.465 N 2610002M06Rik n/a
9 TRCN0000100767 CATCAGTTTGAAACATTGGAT pLKO.1 542 CDS 100% 3.000 2.100 N 2610002M06Rik n/a
10 TRCN0000332055 CATCAGTTTGAAACATTGGAT pLKO_005 542 CDS 100% 3.000 2.100 N 2610002M06Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03790 pDONR223 100% 82% 95.9% None (many diffs) n/a
2 ccsbBroad304_03790 pLX_304 0% 82% 95.9% V5 (many diffs) n/a
3 TRCN0000470343 AGGAACAGCCGACTATTCGATCCG pLX_317 71.6% 82% 95.9% V5 (many diffs) n/a
Download CSV