Transcript: Mouse NM_025939.3

Mus musculus phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase (Paics), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Mus musculus (mouse)
Gene:
Paics (67054)
Length:
2509
CDS:
519..1796

Additional Resources:

NCBI RefSeq record:
NM_025939.3
NBCI Gene record:
Paics (67054)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025939.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076100 CCAGTGGTATTGGCTGTTCAA pLKO.1 1624 CDS 100% 4.950 3.960 N Paics n/a
2 TRCN0000334640 CCAGTGGTATTGGCTGTTCAA pLKO_005 1624 CDS 100% 4.950 3.960 N Paics n/a
3 TRCN0000076101 CTGCTCAGATATTTGGGTTAA pLKO.1 1678 CDS 100% 10.800 7.560 N Paics n/a
4 TRCN0000363773 CTGCTCAGATATTTGGGTTAA pLKO_005 1678 CDS 100% 10.800 7.560 N Paics n/a
5 TRCN0000076098 GCACCTGCTTTCAAATACTAT pLKO.1 2327 3UTR 100% 5.625 3.938 N Paics n/a
6 TRCN0000334642 GCACCTGCTTTCAAATACTAT pLKO_005 2327 3UTR 100% 5.625 3.938 N Paics n/a
7 TRCN0000076099 GCTGATAAGAAGGTCAGACAA pLKO.1 1764 CDS 100% 4.950 3.465 N Paics n/a
8 TRCN0000334641 GCTGATAAGAAGGTCAGACAA pLKO_005 1764 CDS 100% 4.950 3.465 N Paics n/a
9 TRCN0000045775 GCTGCTCAGATATTTGGGTTA pLKO.1 1677 CDS 100% 4.050 2.835 N PAICS n/a
10 TRCN0000286311 GCTGCTCAGATATTTGGGTTA pLKO_005 1677 CDS 100% 4.050 2.835 N PAICS n/a
11 TRCN0000076102 GCTGATGTCATTGATAATGAT pLKO.1 1134 CDS 100% 5.625 3.375 N Paics n/a
12 TRCN0000045776 CGCATAAAGGACCAGATGAAA pLKO.1 1423 CDS 100% 5.625 3.938 N PAICS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025939.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02484 pDONR223 100% 87.8% 95% None (many diffs) n/a
2 ccsbBroad304_02484 pLX_304 0% 87.8% 95% V5 (many diffs) n/a
3 TRCN0000492047 GCATTTTAACATCCAACACCCTAC pLX_317 29.6% 87.8% 95% V5 (many diffs) n/a
Download CSV