Transcript: Mouse NM_025963.3

Mus musculus ribosomal protein S10 (Rps10), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rps10 (67097)
Length:
573
CDS:
40..537

Additional Resources:

NCBI RefSeq record:
NM_025963.3
NBCI Gene record:
Rps10 (67097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436341 TTTAAGGAGGGCGTGATGGTC pLKO_005 85 CDS 100% 2.640 3.696 N Rps10 n/a
2 TRCN0000437364 GCTACGTGAAGGAACAGTTTG pLKO_005 206 CDS 100% 10.800 8.640 N Rps10 n/a
3 TRCN0000437683 AGCGACCTGCAAGATTCACAA pLKO_005 374 CDS 100% 4.950 3.960 N Rps10 n/a
4 TRCN0000104118 CATCCAGTATCTCCGAGACTA pLKO.1 264 CDS 100% 4.950 3.960 N Rps10 n/a
5 TRCN0000104119 CTGACAGAGACACCTACAGAA pLKO.1 404 CDS 100% 4.950 3.960 N Rps10 n/a
6 TRCN0000104116 GCCCAACCTTCATGTAATGAA pLKO.1 159 CDS 100% 5.625 3.938 N Rps10 n/a
7 TRCN0000104117 GTTTGCTTGGAGACATTTCTA pLKO.1 222 CDS 100% 5.625 3.938 N Rps10 n/a
8 TRCN0000104115 CCTTCATGTAATGAAGGCCAT pLKO.1 165 CDS 100% 0.216 0.151 N Rps10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01450 pDONR223 100% 91.1% 98.7% None (many diffs) n/a
2 ccsbBroad304_01450 pLX_304 0% 91.1% 98.7% V5 (many diffs) n/a
3 TRCN0000471438 ATCTAGGGTCGCGATTGTGGTTTG pLX_317 96.1% 91.1% 98.7% V5 (many diffs) n/a
4 ccsbBroadEn_10362 pDONR223 100% 40.6% 36.3% None (many diffs) n/a
5 ccsbBroad304_10362 pLX_304 0% 40.6% 36.3% V5 (many diffs) n/a
6 TRCN0000467822 CGCCTCGGACTAACTGACTCCGAT pLX_317 100% 40.6% 36.3% V5 (many diffs) n/a
Download CSV