Transcript: Mouse NM_026001.2

Mus musculus ribonuclease H2, subunit B (Rnaseh2b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rnaseh2b (67153)
Length:
1457
CDS:
12..938

Additional Resources:

NCBI RefSeq record:
NM_026001.2
NBCI Gene record:
Rnaseh2b (67153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251639 GAGCAGCCTCCTGTTCGTAAA pLKO_005 107 CDS 100% 10.800 15.120 N Rnaseh2b n/a
2 TRCN0000180072 CGCTGAGAATCAAGGTACTTT pLKO.1 1046 3UTR 100% 5.625 4.500 N Rnaseh2b n/a
3 TRCN0000412724 ACACCATTCTTGGTTTATAAA pLKO_005 218 CDS 100% 15.000 10.500 N RNASEH2B n/a
4 TRCN0000251640 TCCTACTTCCAGAACATTTAA pLKO_005 61 CDS 100% 15.000 10.500 N Rnaseh2b n/a
5 TRCN0000251643 GGGACAAGGAAGAGGATTATG pLKO_005 607 CDS 100% 13.200 9.240 N Rnaseh2b n/a
6 TRCN0000180221 CCAGTGAAGCAGAAACAGAAA pLKO.1 956 3UTR 100% 4.950 3.465 N Rnaseh2b n/a
7 TRCN0000184589 GACATTGAAGTGGCTGGAGAA pLKO.1 488 CDS 100% 4.050 2.835 N Rnaseh2b n/a
8 TRCN0000251642 TGAACAGCAAGAAGTACTATA pLKO_005 451 CDS 100% 13.200 7.920 N Rnaseh2b n/a
9 TRCN0000251641 TTTGGGACCTTTGCCATAATG pLKO_005 1159 3UTR 100% 13.200 7.920 N Rnaseh2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.