Transcript: Mouse NM_026045.3

Mus musculus pre-mRNA processing factor 18 (Prpf18), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Prpf18 (67229)
Length:
3431
CDS:
106..1134

Additional Resources:

NCBI RefSeq record:
NM_026045.3
NBCI Gene record:
Prpf18 (67229)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026045.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416884 CGTTGATACTTAGGAACATTT pLKO_005 1445 3UTR 100% 13.200 18.480 N Prpf18 n/a
2 TRCN0000425418 AGATATTATCCGTAGTTTAAG pLKO_005 1360 3UTR 100% 13.200 10.560 N Prpf18 n/a
3 TRCN0000109181 GCGTTTAAGGAAGATAGAGAT pLKO.1 426 CDS 100% 4.950 3.960 N Prpf18 n/a
4 TRCN0000433874 GACCTTCTGCCATCTTGTAAT pLKO_005 1600 3UTR 100% 13.200 9.240 N Prpf18 n/a
5 TRCN0000109180 GCTCGATCTAACTACAGCTTT pLKO.1 2081 3UTR 100% 4.950 3.465 N Prpf18 n/a
6 TRCN0000109182 GTGTGGAGTATAATGCACTAT pLKO.1 1112 CDS 100% 4.950 3.465 N Prpf18 n/a
7 TRCN0000109184 AGAAACCACTAACATCGTCAA pLKO.1 272 CDS 100% 4.050 2.835 N Prpf18 n/a
8 TRCN0000109183 CCAGAAGTTAACAAGGGCTTA pLKO.1 454 CDS 100% 4.050 2.835 N Prpf18 n/a
9 TRCN0000314652 GGAATCTTCCTGCTGATATTA pLKO_005 824 CDS 100% 15.000 9.000 N PRPF18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026045.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07263 pDONR223 100% 89.9% 98.8% None (many diffs) n/a
2 ccsbBroad304_07263 pLX_304 0% 89.9% 98.8% V5 (many diffs) n/a
3 TRCN0000480692 TTCAGCATCACCTTTAACGAACCA pLX_317 42.2% 89.9% 98.8% V5 (many diffs) n/a
Download CSV