Transcript: Mouse NM_026124.3

Mus musculus RIKEN cDNA 1110008F13 gene (1110008F13Rik), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
1110008F13Rik (67388)
Length:
1065
CDS:
183..572

Additional Resources:

NCBI RefSeq record:
NM_026124.3
NBCI Gene record:
1110008F13Rik (67388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026124.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194385 CGGATGAAACATTGTCTTCCT pLKO.1 872 3UTR 100% 2.640 3.696 N 1110008F13Rik n/a
2 TRCN0000292765 CGGATGAAACATTGTCTTCCT pLKO_005 872 3UTR 100% 2.640 3.696 N 1110008F13Rik n/a
3 TRCN0000285289 CAGGATTCTGCCTGATCAATG pLKO_005 397 CDS 100% 10.800 7.560 N RAB5IF n/a
4 TRCN0000174777 GCATTTCTGAATTTGTCCATT pLKO.1 768 3UTR 100% 4.950 3.465 N 1110008F13Rik n/a
5 TRCN0000292693 GCATTTCTGAATTTGTCCATT pLKO_005 768 3UTR 100% 4.950 3.465 N 1110008F13Rik n/a
6 TRCN0000174297 CTTTATGACATCATTTGCCTT pLKO.1 503 CDS 100% 2.640 1.848 N 1110008F13Rik n/a
7 TRCN0000173291 GCTCACCAAAGAAGGCTTTAT pLKO.1 488 CDS 100% 13.200 7.920 N 1110008F13Rik n/a
8 TRCN0000292694 GCTCACCAAAGAAGGCTTTAT pLKO_005 488 CDS 100% 13.200 7.920 N 1110008F13Rik n/a
9 TRCN0000194345 CTTCTTGGGAATAGCAGGATT pLKO.1 383 CDS 100% 4.950 2.970 N 1110008F13Rik n/a
10 TRCN0000292764 CTTCTTGGGAATAGCAGGATT pLKO_005 383 CDS 100% 4.950 2.970 N 1110008F13Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026124.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03688 pDONR223 100% 85.5% 86.1% None (many diffs) n/a
2 ccsbBroad304_03688 pLX_304 0% 85.5% 86.1% V5 (many diffs) n/a
3 TRCN0000466507 TTTCTGGTAGCCAAGGGACACTAG pLX_317 90.4% 85.3% 86.1% V5 (many diffs) n/a
4 ccsbBroadEn_15919 pDONR223 0% 57.6% 52.5% None (many diffs) n/a
5 ccsbBroad304_15919 pLX_304 0% 57.6% 52.5% V5 (many diffs) n/a
Download CSV