Transcript: Mouse NM_026141.3

Mus musculus peptidylprolyl isomerase (cyclophilin)-like 4 (Ppil4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ppil4 (67418)
Length:
2910
CDS:
58..1536

Additional Resources:

NCBI RefSeq record:
NM_026141.3
NBCI Gene record:
Ppil4 (67418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026141.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101208 CCGAGCCTACAAAGGAACAAT pLKO.1 593 CDS 100% 5.625 7.875 N Ppil4 n/a
2 TRCN0000349523 CCGAGCCTACAAAGGAACAAT pLKO_005 593 CDS 100% 5.625 7.875 N Ppil4 n/a
3 TRCN0000314064 CTCAAGATTTGGGCCAATAAG pLKO_005 837 CDS 100% 13.200 10.560 N Ppil4 n/a
4 TRCN0000314063 CACTATGAAAGCTCCATATAT pLKO_005 1882 3UTR 100% 15.000 10.500 N Ppil4 n/a
5 TRCN0000350083 CCGCGGAGGAGAGTCTATATT pLKO_005 237 CDS 100% 15.000 10.500 N Ppil4 n/a
6 TRCN0000101209 CGAGCCTACAAAGGAACAATT pLKO.1 594 CDS 100% 13.200 9.240 N Ppil4 n/a
7 TRCN0000101207 CCAGCCAATTTGGTTCTGAAA pLKO.1 1093 CDS 100% 4.950 3.465 N Ppil4 n/a
8 TRCN0000317659 CCAGCCAATTTGGTTCTGAAA pLKO_005 1093 CDS 100% 4.950 3.465 N Ppil4 n/a
9 TRCN0000049414 GCAGATATTAAACCTCCAGAA pLKO.1 754 CDS 100% 4.050 2.835 N PPIL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026141.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04476 pDONR223 100% 91% 96.7% None (many diffs) n/a
2 ccsbBroad304_04476 pLX_304 0% 91% 96.7% V5 (many diffs) n/a
3 TRCN0000480806 GGTATCATGTAGTCGGCATGCCTT pLX_317 29.1% 91% 96.7% V5 (many diffs) n/a
4 ccsbBroadEn_12908 pDONR223 100% 34.8% 36.1% None (many diffs) n/a
5 ccsbBroad304_12908 pLX_304 0% 34.8% 36.1% V5 (many diffs) n/a
6 TRCN0000469721 CGGAATGTGGGCCCTCCCGAAACT pLX_317 12.2% 34.8% 36.1% V5 (many diffs) n/a
Download CSV