Transcript: Mouse NM_026225.3

Mus musculus component of oligomeric golgi complex 6 (Cog6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cog6 (67542)
Length:
2920
CDS:
26..1999

Additional Resources:

NCBI RefSeq record:
NM_026225.3
NBCI Gene record:
Cog6 (67542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279378 ATGCGGTTGTAGGTCAATTTC pLKO_005 2114 3UTR 100% 13.200 18.480 N Cog6 n/a
2 TRCN0000279379 CAGTGAAGGAGCAGATTATAA pLKO_005 1845 CDS 100% 15.000 10.500 N Cog6 n/a
3 TRCN0000279380 TTGAGTCTCCATGCGAATAAA pLKO_005 1277 CDS 100% 15.000 10.500 N Cog6 n/a
4 TRCN0000202304 GCGCCTAGAAATGCTTCAGTT pLKO.1 1585 CDS 100% 4.950 3.465 N Cog6 n/a
5 TRCN0000279374 GCGCCTAGAAATGCTTCAGTT pLKO_005 1585 CDS 100% 4.950 3.465 N Cog6 n/a
6 TRCN0000200782 GTGGGTTTATTGATGCTCTTA pLKO.1 861 CDS 100% 4.950 3.465 N Cog6 n/a
7 TRCN0000279375 GTGGGTTTATTGATGCTCTTA pLKO_005 861 CDS 100% 4.950 3.465 N Cog6 n/a
8 TRCN0000192008 CGAAGAAATTTACGTGGTGAT pLKO.1 239 CDS 100% 4.050 2.835 N Cog6 n/a
9 TRCN0000201907 CCCATTGAAATGCACTCCCAT pLKO.1 911 CDS 100% 2.640 1.848 N Cog6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08739 pDONR223 100% 85.4% 91% None (many diffs) n/a
2 ccsbBroad304_08739 pLX_304 0% 85.4% 91% V5 (many diffs) n/a
3 TRCN0000479296 TTCCCGGCGCGGAGGACTATCCTG pLX_317 22.6% 85.4% 91% V5 (many diffs) n/a
Download CSV