Transcript: Mouse NM_026242.3

Mus musculus Morf4 family associated protein 1 (Mrfap1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mrfap1 (67568)
Length:
1630
CDS:
162..539

Additional Resources:

NCBI RefSeq record:
NM_026242.3
NBCI Gene record:
Mrfap1 (67568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026242.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192009 CGGAGGATAGTATTGTTTCTA pLKO.1 1134 3UTR 100% 5.625 7.875 N Mrfap1 n/a
2 TRCN0000141423 CTGTGGGAGATGGACAATATG pLKO.1 330 CDS 100% 13.200 9.240 N MRFAP1 n/a
3 TRCN0000191343 CTTTGGTTGTTGTTCCTAAAT pLKO.1 892 3UTR 100% 13.200 9.240 N Mrfap1 n/a
4 TRCN0000122857 GCTGTGGGAGATGGACAATAT pLKO.1 329 CDS 100% 13.200 9.240 N MRFAP1 n/a
5 TRCN0000192623 GCCTTTGGTTGTTGTTCCTAA pLKO.1 890 3UTR 100% 4.950 3.465 N Mrfap1 n/a
6 TRCN0000190082 GATAGAGAAGAGCGAGTCTTC pLKO.1 515 CDS 100% 0.405 0.284 N Mrfap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026242.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04605 pDONR223 100% 84.3% 85% None (many diffs) n/a
2 ccsbBroad304_04605 pLX_304 0% 84.3% 85% V5 (many diffs) n/a
3 TRCN0000474405 TTACTCACTTTATGACCACAACAA pLX_317 100% 84.3% 85% V5 (many diffs) n/a
Download CSV