Transcript: Mouse NM_026247.3

Mus musculus asparagine-linked glycosylation 13 (Alg13), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-08
Taxon:
Mus musculus (mouse)
Gene:
Alg13 (67574)
Length:
1640
CDS:
76..573

Additional Resources:

NCBI RefSeq record:
NM_026247.3
NBCI Gene record:
Alg13 (67574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026247.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178697 CCAGAGAAACTCTGTCTTTAA pLKO.1 926 3UTR 100% 13.200 9.240 N Alg13 n/a
2 TRCN0000182269 GACCTTCAGCAAGCTGATCTT pLKO.1 283 CDS 100% 4.950 3.465 N Alg13 n/a
3 TRCN0000176968 GATTCTTTGAAAGAAGACCTT pLKO.1 268 CDS 100% 2.640 1.584 N Alg13 n/a
4 TRCN0000197569 CTGTTACAGTCAATGGATTTA pLKO.1 472 CDS 100% 13.200 6.600 Y Glt28d2 n/a
5 TRCN0000198483 GTCATTCACTCTGGATGTTTA pLKO.1 237 CDS 100% 13.200 6.600 Y Alg13 n/a
6 TRCN0000198431 GCTGTTACAGTCAATGGATTT pLKO.1 471 CDS 100% 10.800 5.400 Y Alg13 n/a
7 TRCN0000200094 CTGTTTGGAGAGTCTGGAGAA pLKO.1 330 CDS 100% 4.050 2.025 Y Glt28d2 n/a
8 TRCN0000182644 GAGAGTCTGGAGAAAGGCAAA pLKO.1 337 CDS 100% 4.050 2.025 Y Glt28d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026247.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08974 pDONR223 100% 85.5% 86.6% None (many diffs) n/a
2 ccsbBroad304_08974 pLX_304 0% 85.5% 86.6% V5 (many diffs) n/a
3 TRCN0000468097 GAAGCAGCAAATCCCAAGTAACAG pLX_317 69.1% 85.5% 86.6% V5 (many diffs) n/a
Download CSV