Transcript: Mouse NM_026272.3

Mus musculus nuclear prelamin A recognition factor (Narf), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Narf (67608)
Length:
4426
CDS:
90..1478

Additional Resources:

NCBI RefSeq record:
NM_026272.3
NBCI Gene record:
Narf (67608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026272.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249218 CGTACGGCTTTCGCAACATTC pLKO_005 1144 CDS 100% 10.800 15.120 N Narf n/a
2 TRCN0000249216 TAGTAACAGTGAGCCATATTT pLKO_005 2118 3UTR 100% 15.000 10.500 N Narf n/a
3 TRCN0000249219 TCCTCAGTCTCTACCTTATTT pLKO_005 404 CDS 100% 15.000 10.500 N Narf n/a
4 TRCN0000257883 GAGGGACTTTCCACTACTTTA pLKO_005 819 CDS 100% 13.200 9.240 N Narf n/a
5 TRCN0000217915 GTCCTCAGTCTCTACCTTATT pLKO.1 403 CDS 100% 13.200 9.240 N Narf n/a
6 TRCN0000216753 GACATTGCTGTGGATACTTTG pLKO.1 921 CDS 100% 10.800 7.560 N Narf n/a
7 TRCN0000249217 GACATTGCTGTGGATACTTTG pLKO_005 921 CDS 100% 10.800 7.560 N Narf n/a
8 TRCN0000192398 CCCTGCATTTGATGCAATGTA pLKO.1 2277 3UTR 100% 5.625 3.938 N Narf n/a
9 TRCN0000190586 GCAGCAAATGGAAGGGATCTA pLKO.1 1298 CDS 100% 4.950 2.970 N Narf n/a
10 TRCN0000200967 CTCAGGAACAAAGACTTCCAT pLKO.1 1074 CDS 100% 3.000 1.800 N Narf n/a
11 TRCN0000064218 GCTAAATTCAACCTCAGTGTA pLKO.1 429 CDS 100% 4.950 3.465 N NARF n/a
12 TRCN0000299744 GCTAAATTCAACCTCAGTGTA pLKO_005 429 CDS 100% 4.950 3.465 N NARF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026272.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08019 pDONR223 100% 74.9% 76.9% None (many diffs) n/a
2 ccsbBroad304_08019 pLX_304 0% 74.9% 76.9% V5 (many diffs) n/a
3 TRCN0000467775 AATGTCAATCCCCGATGTAATACG pLX_317 24.9% 74.9% 76.9% V5 (many diffs) n/a
Download CSV