Transcript: Mouse NM_026312.5

Mus musculus polysaccharide biosynthesis domain containing 1 (Pbdc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pbdc1 (67683)
Length:
2646
CDS:
59..655

Additional Resources:

NCBI RefSeq record:
NM_026312.5
NBCI Gene record:
Pbdc1 (67683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026312.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446427 TCGGAACCGGGAAGGCTATAA pLKO_005 502 CDS 100% 13.200 18.480 N PBDC1 n/a
2 TRCN0000338049 AGCATGCTGAAGTCTATTATA pLKO_005 192 CDS 100% 15.000 12.000 N Pbdc1 n/a
3 TRCN0000338121 CTTCACAATGTCAGGTATATA pLKO_005 980 3UTR 100% 15.000 10.500 N Pbdc1 n/a
4 TRCN0000178318 GAAGGGATCGTAGAAGATTAT pLKO.1 383 CDS 100% 13.200 9.240 N Pbdc1 n/a
5 TRCN0000338048 GAAGGGATCGTAGAAGATTAT pLKO_005 383 CDS 100% 13.200 9.240 N Pbdc1 n/a
6 TRCN0000436558 GCAGCATGCTGAAGTCTATTA pLKO_005 190 CDS 100% 13.200 9.240 N PBDC1 n/a
7 TRCN0000178664 CACCAAAGTAGATGACCAAAT pLKO.1 250 CDS 100% 10.800 7.560 N Pbdc1 n/a
8 TRCN0000177650 CCAGAAGAACTCAAATCAGAA pLKO.1 323 CDS 100% 4.950 3.465 N Pbdc1 n/a
9 TRCN0000338118 CCAGAAGAACTCAAATCAGAA pLKO_005 323 CDS 100% 4.950 3.465 N Pbdc1 n/a
10 TRCN0000198589 CGGGAAGGCTATAATAAAGCA pLKO.1 509 CDS 100% 3.000 2.100 N Pbdc1 n/a
11 TRCN0000338120 CGGGAAGGCTATAATAAAGCA pLKO_005 509 CDS 100% 3.000 2.100 N Pbdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026312.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03260 pDONR223 100% 72.9% 72.9% None (many diffs) n/a
2 ccsbBroad304_03260 pLX_304 0% 72.9% 72.9% V5 (many diffs) n/a
3 TRCN0000467029 CCCACTCCTTGTCATCCAGAGAGG pLX_317 56% 72.9% 72.9% V5 (many diffs) n/a
Download CSV