Transcript: Mouse NM_026539.2

Mus musculus chromodomain helicase DNA binding protein 1-like (Chd1l), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Chd1l (68058)
Length:
2989
CDS:
20..2722

Additional Resources:

NCBI RefSeq record:
NM_026539.2
NBCI Gene record:
Chd1l (68058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109405 CAAGGCTATCTTTGGTCATAT pLKO.1 2802 3UTR 100% 13.200 18.480 N Chd1l n/a
2 TRCN0000306303 GCGTTCATCTTCCACGAATTG pLKO_005 2544 CDS 100% 10.800 15.120 N Chd1l n/a
3 TRCN0000109408 CATCCCAACTTACATATACTA pLKO.1 2635 CDS 100% 5.625 7.875 N Chd1l n/a
4 TRCN0000109406 CCCAACTTACATATACTACTT pLKO.1 2638 CDS 100% 4.950 6.930 N Chd1l n/a
5 TRCN0000332243 CCCAACTTACATATACTACTT pLKO_005 2638 CDS 100% 4.950 6.930 N Chd1l n/a
6 TRCN0000306363 TGCTGACGACATACGAGATTT pLKO_005 447 CDS 100% 13.200 9.240 N Chd1l n/a
7 TRCN0000306302 TTTCAGCAACCAGTTAGATTC pLKO_005 2748 3UTR 100% 10.800 7.560 N Chd1l n/a
8 TRCN0000109409 GCAGAGAACAGGTGGAAGATT pLKO.1 678 CDS 100% 5.625 3.938 N Chd1l n/a
9 TRCN0000332244 GCAGAGAACAGGTGGAAGATT pLKO_005 678 CDS 100% 5.625 3.938 N Chd1l n/a
10 TRCN0000109407 GCAGCTTACCAACATGGTCAT pLKO.1 1462 CDS 100% 4.050 2.835 N Chd1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11389 pDONR223 100% 64.5% 63.5% None (many diffs) n/a
2 ccsbBroad304_11389 pLX_304 0% 64.5% 63.5% V5 (many diffs) n/a
3 TRCN0000479276 GCTGATGTGCAGGCAAGTTCTTGA pLX_317 18% 64.5% 63.5% V5 (many diffs) n/a
Download CSV