Transcript: Mouse NM_026551.3

Mus musculus dephospho-CoA kinase domain containing (Dcakd), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Dcakd (68087)
Length:
1714
CDS:
194..889

Additional Resources:

NCBI RefSeq record:
NM_026551.3
NBCI Gene record:
Dcakd (68087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024818 GTAATCGACGTGGACGTCATT pLKO.1 275 CDS 100% 4.950 6.930 N Dcakd n/a
2 TRCN0000024814 CCGATACGTGATTCTGGACAT pLKO.1 514 CDS 100% 4.050 5.670 N Dcakd n/a
3 TRCN0000274793 CCGATACGTGATTCTGGACAT pLKO_005 514 CDS 100% 4.050 5.670 N Dcakd n/a
4 TRCN0000024816 CGGCGTATAGTAGAGGCCTTT pLKO.1 332 CDS 100% 4.050 5.670 N Dcakd n/a
5 TRCN0000374394 CCAAGAAGCTGCTCAAGTATA pLKO_005 552 CDS 100% 13.200 9.240 N Dcakd n/a
6 TRCN0000274794 AGTGTACTGTGACCGTGATAC pLKO_005 589 CDS 100% 10.800 7.560 N Dcakd n/a
7 TRCN0000274732 GTCTAGTGGACCACAGCAAAT pLKO_005 1258 3UTR 100% 10.800 7.560 N Dcakd n/a
8 TRCN0000024817 CCAATCACGTTCTGGACAACT pLKO.1 708 CDS 100% 4.950 3.465 N Dcakd n/a
9 TRCN0000274734 CCAATCACGTTCTGGACAACT pLKO_005 708 CDS 100% 4.950 3.465 N Dcakd n/a
10 TRCN0000024815 GCGGCTGATGAAGCGGAACAA pLKO.1 619 CDS 100% 1.650 1.155 N Dcakd n/a
11 TRCN0000323429 GCGGCTGATGAAGCGGAACAA pLKO_005 619 CDS 100% 1.650 1.155 N Dcakd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04143 pDONR223 100% 86% 90.9% None (many diffs) n/a
2 ccsbBroad304_04143 pLX_304 0% 86% 90.9% V5 (many diffs) n/a
3 TRCN0000468920 ACGAGTGCAACTTTACATCTACAT pLX_317 50.2% 86% 90.9% V5 (many diffs) n/a
4 ccsbBroadEn_15156 pDONR223 0% 86% 90.9% None (many diffs) n/a
5 ccsbBroad304_15156 pLX_304 0% 86% 90.9% V5 (many diffs) n/a
6 TRCN0000465914 ACAGGCTATCTCGGTAAAGTGATA pLX_317 35.9% 86% 90.9% V5 (many diffs) n/a
Download CSV