Transcript: Mouse NM_026574.3

Mus musculus INO80 complex subunit (Ino80), mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Ino80 (68142)
Length:
6296
CDS:
295..4974

Additional Resources:

NCBI RefSeq record:
NM_026574.3
NBCI Gene record:
Ino80 (68142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026574.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096375 GCTCTCTACATACGACCCTTT pLKO.1 870 CDS 100% 4.050 5.670 N Ino80 n/a
2 TRCN0000096376 CGGCTGGTCTTTCATCAGAAT pLKO.1 3552 CDS 100% 4.950 3.465 N Ino80 n/a
3 TRCN0000096377 GCCGTTGGATTCTTACTGTAA pLKO.1 3363 CDS 100% 4.950 3.465 N Ino80 n/a
4 TRCN0000096374 CCTCTAATTTGCACACCTGAA pLKO.1 5980 3UTR 100% 4.050 2.835 N Ino80 n/a
5 TRCN0000096378 CGTTGGAAGATTCTCTTACAA pLKO.1 2290 CDS 100% 5.625 3.375 N Ino80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026574.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03442 pDONR223 100% 90.6% 96.8% None (many diffs) n/a
2 ccsbBroad304_03442 pLX_304 0% 90.6% 96.8% V5 (many diffs) n/a
3 TRCN0000476169 TTCGTGAAGTAGAACACGTTCACA pLX_317 8.5% 90.6% 96.8% V5 (many diffs) n/a
Download CSV