Transcript: Mouse NM_026888.3

Mus musculus phosphorylase kinase, gamma 2 (testis) (Phkg2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Phkg2 (68961)
Length:
1644
CDS:
128..1348

Additional Resources:

NCBI RefSeq record:
NM_026888.3
NBCI Gene record:
Phkg2 (68961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145907 AAGACTCGTAGGAATCGATG pXPR_003 AGG 281 23% 4 0.8073 Phkg2 PHKG2 77384
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321724 ATCGTTCAAACACCGTCAAAG pLKO_005 903 CDS 100% 10.800 15.120 N Phkg2 n/a
2 TRCN0000024373 CGGCGAGAGATGCACATTCTT pLKO.1 350 CDS 100% 5.625 7.875 N Phkg2 n/a
3 TRCN0000321720 CGGCGAGAGATGCACATTCTT pLKO_005 350 CDS 100% 5.625 7.875 N Phkg2 n/a
4 TRCN0000024371 CCTAGATGACAATATGCAGAT pLKO.1 607 CDS 100% 4.050 5.670 N Phkg2 n/a
5 TRCN0000024372 CCAAATCCTGATGCTACGCAT pLKO.1 838 CDS 100% 2.640 3.696 N Phkg2 n/a
6 TRCN0000321656 ACGACCCTAAGGACATCATTG pLKO_005 198 CDS 100% 10.800 8.640 N Phkg2 n/a
7 TRCN0000024369 CGAGTCTTCTAGCTTCATGTT pLKO.1 418 CDS 100% 4.950 3.960 N Phkg2 n/a
8 TRCN0000321721 CGAGTCTTCTAGCTTCATGTT pLKO_005 418 CDS 100% 4.950 3.960 N Phkg2 n/a
9 TRCN0000321722 GGACTCTCCAGGAGGACATTT pLKO_005 1378 3UTR 100% 13.200 9.240 N Phkg2 n/a
10 TRCN0000355684 TATTCTCCTAGATGACAATAT pLKO_005 601 CDS 100% 13.200 9.240 N PHKG2 n/a
11 TRCN0000368394 TAAATGCTCCATGGATGAAAC pLKO_005 724 CDS 100% 10.800 7.560 N PHKG2 n/a
12 TRCN0000024370 CCACTAACTAAGAATGCACTA pLKO.1 1115 CDS 100% 4.050 2.835 N Phkg2 n/a
13 TRCN0000010069 GGATGAAACCCACCCAGGCTA pLKO.1 736 CDS 100% 0.880 0.528 N PHKG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01190 pDONR223 100% 89.5% 93.5% None (many diffs) n/a
2 ccsbBroad304_01190 pLX_304 0% 89.5% 93.5% V5 (many diffs) n/a
3 TRCN0000475455 AAGAATGCTGCTGGGTGGGCCAGA pLX_317 30.1% 89.5% 93.5% V5 (many diffs) n/a
4 ccsbBroadEn_14756 pDONR223 0% 89.5% 93.5% None (many diffs) n/a
5 ccsbBroad304_14756 pLX_304 0% 89.5% 93.5% V5 (many diffs) n/a
6 TRCN0000472787 CGCCGTGTAGCGCACTTGAAAACC pLX_317 32.4% 89.5% 93.5% V5 (many diffs) n/a
7 TRCN0000488203 GGCTCTATTTCGACCACATATCCC pLX_317 28.7% 89.5% 93.5% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489697 ACCTTGCTCTTAACTTGACGTGTT pLX_317 30% 89.5% 93.3% V5 (many diffs) n/a
Download CSV