Transcript: Mouse NM_026891.2

Mus musculus congenital dyserythropoietic anemia, type I (human) (Cdan1), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Cdan1 (68968)
Length:
6384
CDS:
17..3736

Additional Resources:

NCBI RefSeq record:
NM_026891.2
NBCI Gene record:
Cdan1 (68968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026891.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254521 GTGGACCAGCAGCTGTTATAT pLKO_005 2399 CDS 100% 15.000 10.500 N Cdan1 n/a
2 TRCN0000254523 ATGTGCCCAAAGATAGTATTT pLKO_005 5001 3UTR 100% 13.200 9.240 N Cdan1 n/a
3 TRCN0000254522 CAGCACCTCATGGATAGTTTA pLKO_005 1784 CDS 100% 13.200 9.240 N Cdan1 n/a
4 TRCN0000254519 CCAACATCACAGCGCTGATTA pLKO_005 2967 CDS 100% 13.200 9.240 N Cdan1 n/a
5 TRCN0000083532 CCACCTCATCTCCGAGATAAA pLKO.1 3106 CDS 100% 13.200 9.240 N CDAN1 n/a
6 TRCN0000254520 CTGCGCTTACATCGGAGTTTG pLKO_005 2192 CDS 100% 10.800 7.560 N Cdan1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026891.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09624 pDONR223 100% 85.6% 87.5% None (many diffs) n/a
2 ccsbBroad304_09624 pLX_304 0% 85.6% 87.5% V5 (many diffs) n/a
3 TRCN0000480914 TTACTAAAATTAAGAAAAATACCC pLX_317 10.8% 85.6% 87.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV