Transcript: Mouse NM_027000.4

Mus musculus GTP binding protein 4 (Gtpbp4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gtpbp4 (69237)
Length:
2579
CDS:
17..1921

Additional Resources:

NCBI RefSeq record:
NM_027000.4
NBCI Gene record:
Gtpbp4 (69237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027000.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247928 TGGACGAATGTGTACTATTAT pLKO_005 418 CDS 100% 15.000 21.000 N Gtpbp4 n/a
2 TRCN0000247930 TAAAGATTATGTGCGTCTTAT pLKO_005 346 CDS 100% 13.200 18.480 N Gtpbp4 n/a
3 TRCN0000175265 CGTCTTATGAAATATGGTGAT pLKO.1 359 CDS 100% 4.050 5.670 N Gtpbp4 n/a
4 TRCN0000216456 GAGCTTAAACTACTCTTAAAT pLKO.1 2320 3UTR 100% 15.000 12.000 N Gtpbp4 n/a
5 TRCN0000247931 TGTCACCTAAAGTACCTATTT pLKO_005 2230 3UTR 100% 13.200 10.560 N Gtpbp4 n/a
6 TRCN0000247927 GCCACAATGTTGCTGATTATA pLKO_005 1320 CDS 100% 15.000 10.500 N Gtpbp4 n/a
7 TRCN0000247929 TGTTGGGCACATGGATTATAA pLKO_005 634 CDS 100% 15.000 10.500 N Gtpbp4 n/a
8 TRCN0000193980 GAGAATGAGATGCGTAGTCTT pLKO.1 1577 CDS 100% 4.950 3.465 N Gtpbp4 n/a
9 TRCN0000193828 CCAAATACAAGGACTCTGCTT pLKO.1 512 CDS 100% 2.640 1.584 N Gtpbp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027000.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07905 pDONR223 100% 89% 94.7% None (many diffs) n/a
Download CSV