Transcript: Mouse NM_027135.2

Mus musculus Sec24 related gene family, member D (S. cerevisiae) (Sec24d), mRNA.

Source:
NCBI, updated 2017-04-26
Taxon:
Mus musculus (mouse)
Gene:
Sec24d (69608)
Length:
3881
CDS:
84..3182

Additional Resources:

NCBI RefSeq record:
NM_027135.2
NBCI Gene record:
Sec24d (69608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027135.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379464 CAATCTGTGATCCACAATTTA pLKO_005 1680 CDS 100% 15.000 21.000 N Sec24d n/a
2 TRCN0000313537 GATTCACAATCTCGCCTTAAA pLKO_005 2366 CDS 100% 13.200 18.480 N Sec24d n/a
3 TRCN0000313538 TCCGGGAAATTCTAGTCAATC pLKO_005 2497 CDS 100% 10.800 15.120 N Sec24d n/a
4 TRCN0000065169 CCACCATTCTATTTCCAACAT pLKO.1 1266 CDS 100% 4.950 6.930 N SEC24D n/a
5 TRCN0000349893 CCAGAGGTGGACAAGTCTATA pLKO_005 913 CDS 100% 13.200 9.240 N Sec24d n/a
6 TRCN0000381547 GACCGACCTCCGGAATGATAT pLKO_005 2105 CDS 100% 13.200 9.240 N Sec24d n/a
7 TRCN0000313466 GTCGCTGGGATCCTATGAATA pLKO_005 1334 CDS 100% 13.200 9.240 N Sec24d n/a
8 TRCN0000382421 ATTGATGTCTCATATAGTAAC pLKO_005 1419 CDS 100% 10.800 7.560 N Sec24d n/a
9 TRCN0000100514 CACAATTTATTGGACCAGATT pLKO.1 1692 CDS 100% 4.950 3.465 N Sec24d n/a
10 TRCN0000100510 CGTGATGACATTAAACAGAAT pLKO.1 3605 3UTR 100% 4.950 3.465 N Sec24d n/a
11 TRCN0000317077 CGTGATGACATTAAACAGAAT pLKO_005 3605 3UTR 100% 4.950 3.465 N Sec24d n/a
12 TRCN0000100512 CCACAATTTATTGGACCAGAT pLKO.1 1691 CDS 100% 4.050 2.835 N Sec24d n/a
13 TRCN0000100511 GCTGTGAAACTGATGCCCTTA pLKO.1 2419 CDS 100% 4.050 2.835 N Sec24d n/a
14 TRCN0000100513 CCCTTGTACTTGGTAAACCAT pLKO.1 1128 CDS 100% 3.000 2.100 N Sec24d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027135.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11426 pDONR223 100% 83.5% 88% None (many diffs) n/a
2 ccsbBroad304_11426 pLX_304 0% 83.5% 88% V5 (many diffs) n/a
Download CSV