Transcript: Mouse NM_027157.3

Mus musculus keratin associated protein 1-5 (Krtap1-5), mRNA.

Source:
NCBI, updated 2013-08-22
Taxon:
Mus musculus (mouse)
Gene:
Krtap1-5 (69664)
Length:
1042
CDS:
52..420

Additional Resources:

NCBI RefSeq record:
NM_027157.3
NBCI Gene record:
Krtap1-5 (69664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027157.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098490 CCACCTATTAAGAGCTAATTT pLKO.1 422 3UTR 100% 15.000 12.000 N Krtap1-5 n/a
2 TRCN0000452199 AGAACAATCTGTAATCCTATT pLKO_005 728 3UTR 100% 10.800 7.560 N Krtap1-5 n/a
3 TRCN0000098492 TGCTGTGTGGTGAGCTGTATA pLKO.1 295 CDS 100% 13.200 7.920 N Krtap1-5 n/a
4 TRCN0000440166 CCAACTTCTGGCTGCTAAGAA pLKO_005 872 3UTR 100% 5.625 2.813 Y Krtap1-5 n/a
5 TRCN0000098494 CTGTTGCTGCTACTGCTGCTA pLKO.1 399 CDS 100% 2.640 1.320 Y Krtap1-5 n/a
6 TRCN0000098493 CCGTCCATCCTACTGTGGACA pLKO.1 360 CDS 100% 0.088 0.044 Y Krtap1-5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027157.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14293 pDONR223 100% 60.7% 27% None (many diffs) n/a
2 ccsbBroad304_14293 pLX_304 0% 60.7% 27% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476992 TTGCGATTATTTGTACTGCCTCTC pLX_317 65.1% 60.7% 27% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV