Transcript: Mouse NM_027189.2

Mus musculus gem nuclear organelle associated protein 7 (Gemin7), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gemin7 (69731)
Length:
763
CDS:
44..433

Additional Resources:

NCBI RefSeq record:
NM_027189.2
NBCI Gene record:
Gemin7 (69731)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027189.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125740 GCTTCGATGTAGTGACATAAT pLKO.1 391 CDS 100% 13.200 18.480 N Gemin7 n/a
2 TRCN0000303252 GCTTCGATGTAGTGACATAAT pLKO_005 391 CDS 100% 13.200 18.480 N Gemin7 n/a
3 TRCN0000125742 GAAGTCGGAGAAGGTCATATT pLKO.1 158 CDS 100% 13.200 9.240 N Gemin7 n/a
4 TRCN0000303253 GAAGTCGGAGAAGGTCATATT pLKO_005 158 CDS 100% 13.200 9.240 N Gemin7 n/a
5 TRCN0000125739 CCAACAAACTCTGGCTTTGAA pLKO.1 538 3UTR 100% 5.625 3.938 N Gemin7 n/a
6 TRCN0000315552 CCAACAAACTCTGGCTTTGAA pLKO_005 538 3UTR 100% 5.625 3.938 N Gemin7 n/a
7 TRCN0000125741 GCCAACTTCTACGTTTCCCAA pLKO.1 335 CDS 100% 2.640 1.848 N Gemin7 n/a
8 TRCN0000303183 GCCAACTTCTACGTTTCCCAA pLKO_005 335 CDS 100% 2.640 1.848 N Gemin7 n/a
9 TRCN0000125743 GCTTTGCCTCTGATGGACGTA pLKO.1 120 CDS 100% 2.640 1.848 N Gemin7 n/a
10 TRCN0000303184 GCTTTGCCTCTGATGGACGTA pLKO_005 120 CDS 100% 2.640 1.848 N Gemin7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027189.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04120 pDONR223 100% 78.1% 80.7% None (many diffs) n/a
2 ccsbBroad304_04120 pLX_304 0% 78.1% 80.7% V5 (many diffs) n/a
3 TRCN0000471137 CCTCCCCTATAAGAAAGGCACTCA pLX_317 100% 78.1% 80.7% V5 (many diffs) n/a
Download CSV