Transcript: Mouse NM_027270.2

Mus musculus exocyst complex component 1 (Exoc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Exoc1 (69940)
Length:
3396
CDS:
163..2868

Additional Resources:

NCBI RefSeq record:
NM_027270.2
NBCI Gene record:
Exoc1 (69940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254146 CTGGATGGAGGCTCGTTATTA pLKO_005 1846 CDS 100% 15.000 21.000 N Exoc1 n/a
2 TRCN0000254148 TCAGGACATTCTGGATTATTG pLKO_005 2823 CDS 100% 13.200 18.480 N Exoc1 n/a
3 TRCN0000129847 CCCGACTATATGAAAGAGAAA pLKO.1 1427 CDS 100% 4.950 6.930 N EXOC1 n/a
4 TRCN0000254145 TCCATGCAAGATGAGTTTATA pLKO_005 2728 CDS 100% 15.000 10.500 N Exoc1 n/a
5 TRCN0000254147 ATGTGCCAGTTGCTCACAAAT pLKO_005 3205 3UTR 100% 13.200 9.240 N Exoc1 n/a
6 TRCN0000413468 TTTGACAAATGCATTAGTAAC pLKO_005 2122 CDS 100% 10.800 7.560 N EXOC1 n/a
7 TRCN0000127717 GAGTGGCTAAAGAGTACAGAT pLKO.1 1360 CDS 100% 4.950 3.465 N EXOC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08582 pDONR223 100% 87.7% 96.4% None (many diffs) n/a
2 ccsbBroad304_08582 pLX_304 0% 87.7% 96.4% V5 (many diffs) n/a
3 TRCN0000477377 GATACTTTAGACAAAGATTTATGT pLX_317 13.6% 87.7% 96.4% V5 (many diffs) n/a
Download CSV