Transcript: Mouse NM_027299.5

Mus musculus delta(4)-desaturase, sphingolipid 2 (Degs2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Degs2 (70059)
Length:
1296
CDS:
65..1036

Additional Resources:

NCBI RefSeq record:
NM_027299.5
NBCI Gene record:
Degs2 (70059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027299.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099451 GCGGAAGATTGCACCTGAATA pLKO.1 892 CDS 100% 13.200 10.560 N Degs2 n/a
2 TRCN0000099450 CCCAGCAAGTAGATAGATACA pLKO.1 1135 3UTR 100% 4.950 3.960 N Degs2 n/a
3 TRCN0000099452 CCTTACGCTACATCCTTCAAA pLKO.1 419 CDS 100% 5.625 3.938 N Degs2 n/a
4 TRCN0000099453 GCATTTGATGTCACCATCTTT pLKO.1 647 CDS 100% 5.625 3.375 N Degs2 n/a
5 TRCN0000099454 TGCGGAAGATTGCACCTGAAT pLKO.1 891 CDS 100% 4.950 2.970 N Degs2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027299.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09476 pDONR223 100% 82.5% 86% None (many diffs) n/a
2 ccsbBroad304_09476 pLX_304 0% 82.5% 86% V5 (many diffs) n/a
3 TRCN0000477175 TAGTTTTCAAACACCGATGGCATA pLX_317 37% 82.5% 86% V5 (many diffs) n/a
Download CSV