Transcript: Mouse NM_027334.3

Mus musculus methyltransferase like 7A1 (Mettl7a1), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Mettl7a1 (70152)
Length:
1883
CDS:
31..765

Additional Resources:

NCBI RefSeq record:
NM_027334.3
NBCI Gene record:
Mettl7a1 (70152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027334.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097560 CGTGATGTACAATGAGCAGAT pLKO.1 162 CDS 100% 4.050 2.835 N Mettl7a1 n/a
2 TRCN0000335663 CGTGATGTACAATGAGCAGAT pLKO_005 162 CDS 100% 4.050 2.835 N Mettl7a1 n/a
3 TRCN0000097561 GAAGCTAAAGCTACAGCACAT pLKO.1 684 CDS 100% 4.050 2.835 N Mettl7a1 n/a
4 TRCN0000335665 GAAGCTAAAGCTACAGCACAT pLKO_005 684 CDS 100% 4.050 2.835 N Mettl7a1 n/a
5 TRCN0000097563 CGGAGCCAACTTCAAGTTCTA pLKO.1 273 CDS 100% 4.950 2.970 N Mettl7a1 n/a
6 TRCN0000335664 CGGAGCCAACTTCAAGTTCTA pLKO_005 273 CDS 100% 4.950 2.970 N Mettl7a1 n/a
7 TRCN0000347708 GAACGGTCTACCTGGAATTAC pLKO_005 565 CDS 100% 13.200 6.600 Y Mettl7a3 n/a
8 TRCN0000097569 CCCGGTAAGAAGGAATCAGAA pLKO.1 1088 3UTR 100% 4.950 2.475 Y Mettl7a2 n/a
9 TRCN0000097559 CCGAATAAATAAATCCCAGAA pLKO.1 1015 3UTR 100% 4.050 2.025 Y Mettl7a1 n/a
10 TRCN0000183893 CTTCAGCAATCTGCAGGAGTT pLKO.1 204 CDS 100% 4.050 2.025 Y Methig1 n/a
11 TRCN0000097562 CCCATGTTTCTGCTGAACCTT pLKO.1 82 CDS 100% 3.000 1.500 Y Mettl7a1 n/a
12 TRCN0000335743 CCCATGTTTCTGCTGAACCTT pLKO_005 82 CDS 100% 3.000 1.500 Y Mettl7a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027334.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.