Transcript: Mouse NM_027444.3

Mus musculus bobby sox HMG box containing (Bbx), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Bbx (70508)
Length:
8742
CDS:
304..3027

Additional Resources:

NCBI RefSeq record:
NM_027444.3
NBCI Gene record:
Bbx (70508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027444.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244357 GACATGGCCAAGGAGTATAAA pLKO_005 694 CDS 100% 15.000 21.000 N Bbx n/a
2 TRCN0000086430 CCTATTACATTTGACCGGAAA pLKO.1 2407 CDS 100% 4.050 5.670 N Bbx n/a
3 TRCN0000086431 CTATTACATTTGACCGGAAAT pLKO.1 2408 CDS 100% 10.800 8.640 N Bbx n/a
4 TRCN0000016936 CGCAGGCTCCTGTACTTATTT pLKO.1 2990 CDS 100% 15.000 10.500 N BBX n/a
5 TRCN0000244258 GGACTTGCAGGCCTGATATTT pLKO_005 980 CDS 100% 15.000 10.500 N Bbx n/a
6 TRCN0000436345 AGACATGGCCAAGGAGTATAA pLKO_005 693 CDS 100% 13.200 9.240 N BBX n/a
7 TRCN0000244358 ATGTCCTCAGAATCGACTAAA pLKO_005 2467 CDS 100% 13.200 9.240 N Bbx n/a
8 TRCN0000244257 TCTACCCTAGCCTTGTCTTTA pLKO_005 3063 3UTR 100% 13.200 9.240 N Bbx n/a
9 TRCN0000244359 TGTGCCATCCTCACGGAATTA pLKO_005 1583 CDS 100% 13.200 9.240 N Bbx n/a
10 TRCN0000086429 CCTCCAGATTTCCTTAGCATT pLKO.1 1951 CDS 100% 4.950 3.465 N Bbx n/a
11 TRCN0000086432 GCTACCAAGATACTAGCTGAT pLKO.1 631 CDS 100% 4.050 2.835 N Bbx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027444.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12321 pDONR223 100% 54% 35.4% None (many diffs) n/a
2 ccsbBroad304_12321 pLX_304 0% 54% 35.4% V5 (many diffs) n/a
3 TRCN0000481585 GAACTGATCATAGAGGGAGGCTGA pLX_317 30% 54% 35.4% V5 (many diffs) n/a
Download CSV