Transcript: Mouse NM_027760.2

Mus musculus Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (Rassf8), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rassf8 (71323)
Length:
1733
CDS:
78..1337

Additional Resources:

NCBI RefSeq record:
NM_027760.2
NBCI Gene record:
Rassf8 (71323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121038 CCCAGTAATCTTCGTATTCTA pLKO.1 1269 CDS 100% 5.625 7.875 N Rassf8 n/a
2 TRCN0000345563 CCCAGTAATCTTCGTATTCTA pLKO_005 1269 CDS 100% 5.625 7.875 N Rassf8 n/a
3 TRCN0000121037 GCAAAGCCTTTGTTTGTATTT pLKO.1 1537 3UTR 100% 13.200 9.240 N Rassf8 n/a
4 TRCN0000345565 GCAAAGCCTTTGTTTGTATTT pLKO_005 1537 3UTR 100% 13.200 9.240 N Rassf8 n/a
5 TRCN0000121041 GAGCTAGAGCAGTTGACCAAA pLKO.1 1083 CDS 100% 4.950 3.465 N Rassf8 n/a
6 TRCN0000121040 CCCGAATTCCTGAAAGAACTT pLKO.1 358 CDS 100% 0.000 0.000 N Rassf8 n/a
7 TRCN0000345562 CCCGAATTCCTGAAAGAACTT pLKO_005 358 CDS 100% 0.000 0.000 N Rassf8 n/a
8 TRCN0000121039 CAGGAGGTTGTAATAGCCTTA pLKO.1 147 CDS 100% 4.050 2.025 Y Rassf8 n/a
9 TRCN0000345561 CAGGAGGTTGTAATAGCCTTA pLKO_005 147 CDS 100% 4.050 2.025 Y Rassf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02651 pDONR223 100% 76% 82.5% None (many diffs) n/a
2 ccsbBroad304_02651 pLX_304 0% 76% 82.5% V5 (many diffs) n/a
3 TRCN0000473922 GCCCGTTACTCTTGTGCTATACGC pLX_317 46.5% 76% 82.5% V5 (many diffs) n/a
Download CSV