Transcript: Mouse NM_027875.1

Mus musculus synapse defective 1, Rho GTPase, homolog 1 (C. elegans) (Syde1), mRNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Mus musculus (mouse)
Gene:
Syde1 (71709)
Length:
3288
CDS:
76..2289

Additional Resources:

NCBI RefSeq record:
NM_027875.1
NBCI Gene record:
Syde1 (71709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105680 CCCTCCCTTGAAGTATCTAAA pLKO.1 2762 3UTR 100% 13.200 9.240 N Syde1 n/a
2 TRCN0000105681 CACCTGAATCTCAAAGACTTT pLKO.1 2209 CDS 100% 4.950 3.465 N Syde1 n/a
3 TRCN0000105684 GACTTCTTTACGCCAAGCTAA pLKO.1 1193 CDS 100% 4.950 3.465 N Syde1 n/a
4 TRCN0000105682 GCACCGTATTTGAGGCCCAAA pLKO.1 1918 CDS 100% 4.050 2.835 N Syde1 n/a
5 TRCN0000105683 GTCGTGAGAAACTTCCTCGAA pLKO.1 119 CDS 100% 2.640 1.848 N Syde1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12910 pDONR223 100% 74.8% 79.9% None (many diffs) n/a
2 ccsbBroad304_12910 pLX_304 0% 74.8% 79.9% V5 (many diffs) n/a
3 TRCN0000475649 TAACTCCCCCACTGTCACAGCAAG pLX_317 10.8% 74.8% 79.9% V5 (many diffs) n/a
Download CSV