Transcript: Mouse NM_028151.2

Mus musculus superkiller viralicidic activity 2-like 2 (S. cerevisiae) (Skiv2l2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Skiv2l2 (72198)
Length:
3309
CDS:
24..3146

Additional Resources:

NCBI RefSeq record:
NM_028151.2
NBCI Gene record:
Skiv2l2 (72198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112074 GCCCTATTAAGGCTCTAAGTA pLKO.1 583 CDS 100% 5.625 7.875 N Skiv2l2 n/a
2 TRCN0000308987 GCCCTATTAAGGCTCTAAGTA pLKO_005 583 CDS 100% 5.625 7.875 N Skiv2l2 n/a
3 TRCN0000112071 CCATCAAATGTGTTCAAGATT pLKO.1 1128 CDS 100% 5.625 3.938 N Skiv2l2 n/a
4 TRCN0000308988 CCATCAAATGTGTTCAAGATT pLKO_005 1128 CDS 100% 5.625 3.938 N Skiv2l2 n/a
5 TRCN0000112072 CCCAAACTAACAGAGCAGTTA pLKO.1 2781 CDS 100% 4.950 3.465 N Skiv2l2 n/a
6 TRCN0000308989 CCCAAACTAACAGAGCAGTTA pLKO_005 2781 CDS 100% 4.950 3.465 N Skiv2l2 n/a
7 TRCN0000112070 GTTATCCACCACCTGTCTGAT pLKO.1 3155 3UTR 100% 4.950 3.465 N Skiv2l2 n/a
8 TRCN0000308921 GTTATCCACCACCTGTCTGAT pLKO_005 3155 3UTR 100% 4.950 3.465 N Skiv2l2 n/a
9 TRCN0000112073 CCACTGCAACACTACATATTT pLKO.1 960 CDS 100% 15.000 9.000 N Skiv2l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07894 pDONR223 100% 88.2% 97.4% None (many diffs) n/a
2 ccsbBroad304_07894 pLX_304 0% 88.2% 97.4% V5 (many diffs) n/a
3 TRCN0000476146 GTAACACGGTGTGCGGCATGCGCC pLX_317 13.8% 88.2% 97.4% V5 (many diffs) n/a
Download CSV