Transcript: Mouse NM_028439.2

Mus musculus RIKEN cDNA 3110009E18 gene (3110009E18Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
3110009E18Rik (73103)
Length:
520
CDS:
44..424

Additional Resources:

NCBI RefSeq record:
NM_028439.2
NBCI Gene record:
3110009E18Rik (73103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028439.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176781 CGATACACTAAAGATTCTTCA pLKO.1 226 CDS 100% 4.950 6.930 N 3110009E18Rik n/a
2 TRCN0000320311 CGATACACTAAAGATTCTTCA pLKO_005 226 CDS 100% 4.950 6.930 N 3110009E18Rik n/a
3 TRCN0000198249 GATTCTTCATCAAGCTCACAA pLKO.1 238 CDS 100% 4.950 3.960 N 3110009E18Rik n/a
4 TRCN0000320240 GATTCTTCATCAAGCTCACAA pLKO_005 238 CDS 100% 4.950 3.960 N 3110009E18Rik n/a
5 TRCN0000177609 CAGTGAAACTGAAATTGCATT pLKO.1 349 CDS 100% 4.950 3.465 N 3110009E18Rik n/a
6 TRCN0000320313 CAGTGAAACTGAAATTGCATT pLKO_005 349 CDS 100% 4.950 3.465 N 3110009E18Rik n/a
7 TRCN0000181881 GCATTCTTCTGTGGAGAAGAT pLKO.1 365 CDS 100% 0.495 0.347 N 3110009E18Rik n/a
8 TRCN0000320315 GCATTCTTCTGTGGAGAAGAT pLKO_005 365 CDS 100% 0.495 0.347 N 3110009E18Rik n/a
9 TRCN0000144100 CCAGTGAAACTGAAATTGCAT pLKO.1 348 CDS 100% 3.000 1.800 N C2orf76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028439.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04860 pDONR223 100% 86.2% 83.3% None (many diffs) n/a
2 ccsbBroad304_04860 pLX_304 0% 86.2% 83.3% V5 (many diffs) n/a
3 TRCN0000470846 AAGGCAACAGCAAATGCTGTGGCG pLX_317 94.7% 86.2% 83.3% V5 (many diffs) n/a
Download CSV