Transcript: Mouse NM_028707.4

Mus musculus pleckstrin and Sec7 domain containing 2 (Psd2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Psd2 (74002)
Length:
4628
CDS:
431..2743

Additional Resources:

NCBI RefSeq record:
NM_028707.4
NBCI Gene record:
Psd2 (74002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028707.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110101 CGTGGCTGGAAGAAATTCTAT pLKO.1 2030 CDS 100% 5.625 4.500 N Psd2 n/a
2 TRCN0000110102 GCGTGGCTGGAAGAAATTCTA pLKO.1 2029 CDS 100% 5.625 3.938 N Psd2 n/a
3 TRCN0000165014 GCGTGGCTGGAAGAAATTCTA pLKO.1 2029 CDS 100% 5.625 3.938 N PSD2 n/a
4 TRCN0000110100 GCTGCCTGAAAGTCCTTTGAT pLKO.1 4320 3UTR 100% 5.625 3.938 N Psd2 n/a
5 TRCN0000110103 CTCAAGTCTAAGGAAGCAGAA pLKO.1 2477 CDS 100% 4.050 2.835 N Psd2 n/a
6 TRCN0000110104 CCTTAACCTCTCTTTGACCAA pLKO.1 640 CDS 100% 2.640 1.848 N Psd2 n/a
7 TRCN0000161114 GCAATTCATTGCCAACTTGGA pLKO.1 1717 CDS 100% 2.640 1.848 N PSD2 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3323 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028707.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09163 pDONR223 100% 85.2% 87.8% None (many diffs) n/a
2 ccsbBroad304_09163 pLX_304 0% 85.2% 87.8% V5 (many diffs) n/a
3 TRCN0000466580 GGTACAGTAATTATGTAACTCTCC pLX_317 14.5% 85.2% 87.8% V5 (many diffs) n/a
Download CSV