Transcript: Mouse NM_028767.2

Mus musculus forkhead box P4 (Foxp4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Mus musculus (mouse)
Gene:
Foxp4 (74123)
Length:
4017
CDS:
445..2463

Additional Resources:

NCBI RefSeq record:
NM_028767.2
NBCI Gene record:
Foxp4 (74123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220225 CCAGTTTATCAAACACCTCAA pLKO.1 1425 CDS 100% 4.050 3.240 N FOXP4 n/a
2 TRCN0000274894 CCAGTTTATCAAACACCTCAA pLKO_005 1425 CDS 100% 4.050 3.240 N FOXP4 n/a
3 TRCN0000071484 CCCTCCTTCACTTAAGTTATT pLKO.1 3438 3UTR 100% 13.200 9.240 N Foxp4 n/a
4 TRCN0000071486 CAGAGCTGGAAACGATGAGAT pLKO.1 3699 3UTR 100% 4.950 3.465 N Foxp4 n/a
5 TRCN0000220227 CCAGAATCATGAGTTCTACAA pLKO.1 1785 CDS 100% 4.950 3.465 N FOXP4 n/a
6 TRCN0000274832 CCAGAATCATGAGTTCTACAA pLKO_005 1785 CDS 100% 4.950 3.465 N FOXP4 n/a
7 TRCN0000071485 CCGCAGGAGAAGTAATGACAA pLKO.1 1734 CDS 100% 4.950 3.465 N Foxp4 n/a
8 TRCN0000071487 CAGATGCAACAGTTGCAGCAA pLKO.1 1015 CDS 100% 2.640 1.848 N Foxp4 n/a
9 TRCN0000071483 GCTGACGCTAAATGAGATTTA pLKO.1 1881 CDS 100% 13.200 7.920 N Foxp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467359 GCGGCTCATTGTCAACTTTCAGGT pLX_317 17.7% 87.6% 91.8% V5 (many diffs) n/a
2 ccsbBroadEn_09429 pDONR223 100% 86% 90% None (many diffs) n/a
Download CSV