Transcript: Mouse NM_029705.3

Mus musculus ataxin 3 (Atxn3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Atxn3 (110616)
Length:
5376
CDS:
87..1154

Additional Resources:

NCBI RefSeq record:
NM_029705.3
NBCI Gene record:
Atxn3 (110616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123959 GCCAATATACACTTCAGCTTT pLKO.1 3007 3UTR 100% 4.950 6.930 N Atxn3 n/a
2 TRCN0000123963 CTCGCACTATTCTTGGCTCAA pLKO.1 528 CDS 100% 4.050 5.670 N Atxn3 n/a
3 TRCN0000423485 TTGACGGGTCCAGAATTAATA pLKO_005 495 CDS 100% 15.000 12.000 N ATXN3 n/a
4 TRCN0000435828 ACAGCAGCCTTCTGGAAATAT pLKO_005 272 CDS 100% 15.000 10.500 N ATXN3 n/a
5 TRCN0000123962 GCTCAGAATTGATCCTATAAA pLKO.1 389 CDS 100% 15.000 10.500 N Atxn3 n/a
6 TRCN0000123960 CGCACTATTCTTGGCTCAATT pLKO.1 530 CDS 100% 13.200 9.240 N Atxn3 n/a
7 TRCN0000412482 GCAGCTGTGACCATGTCTTTA pLKO_005 1092 CDS 100% 13.200 9.240 N ATXN3 n/a
8 TRCN0000123961 GCTCACTTTGTGCTCAGCATT pLKO.1 118 CDS 100% 4.950 3.465 N Atxn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13896 pDONR223 100% 84% 81.9% None (many diffs) n/a
2 ccsbBroad304_13896 pLX_304 0% 84% 81.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470627 AGGGTCAACTTGCCCGAATTCAAC pLX_317 41.5% 84% 81.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV