Transcript: Mouse NM_030026.2

Mus musculus methylcrotonoyl-Coenzyme A carboxylase 2 (beta) (Mccc2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mccc2 (78038)
Length:
2146
CDS:
126..1817

Additional Resources:

NCBI RefSeq record:
NM_030026.2
NBCI Gene record:
Mccc2 (78038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197905 GCATATTCTATAATCAGGCAA pLKO.1 703 CDS 100% 2.640 3.696 N Mccc2 n/a
2 TRCN0000200086 CCGAGAGGTCATTGCTAGAAT pLKO.1 1118 CDS 100% 5.625 3.938 N Mccc2 n/a
3 TRCN0000298148 CCGAGAGGTCATTGCTAGAAT pLKO_005 1118 CDS 100% 5.625 3.938 N Mccc2 n/a
4 TRCN0000177366 GACAGAATCGACAATCTCATA pLKO.1 378 CDS 100% 4.950 3.465 N Mccc2 n/a
5 TRCN0000293101 GACAGAATCGACAATCTCATA pLKO_005 378 CDS 100% 4.950 3.465 N Mccc2 n/a
6 TRCN0000197773 GAGGAGTCTCAATTATCAGAA pLKO.1 998 CDS 100% 4.950 3.465 N Mccc2 n/a
7 TRCN0000293100 GAGGAGTCTCAATTATCAGAA pLKO_005 998 CDS 100% 4.950 3.465 N Mccc2 n/a
8 TRCN0000177208 GTGCCTAAGATAACTGTCATA pLKO.1 1425 CDS 100% 4.950 2.970 N Mccc2 n/a
9 TRCN0000293099 GTGCCTAAGATAACTGTCATA pLKO_005 1425 CDS 100% 4.950 2.970 N Mccc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08829 pDONR223 100% 84.1% 88.8% None (many diffs) n/a
2 ccsbBroad304_08829 pLX_304 0% 84.1% 88.8% V5 (many diffs) n/a
3 TRCN0000467380 AGCCAGCAACAATTAACCAACAAT pLX_317 21.3% 84.1% 88.8% V5 (many diffs) n/a
Download CSV