Transcript: Mouse NM_030091.1

Mus musculus Obg-like ATPase 1 (Ola1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ola1 (67059)
Length:
1019
CDS:
163..975

Additional Resources:

NCBI RefSeq record:
NM_030091.1
NBCI Gene record:
Ola1 (67059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217013 CAATGGTCTACTTGGTGAATC pLKO.1 833 CDS 100% 10.800 8.640 N Ola1 n/a
2 TRCN0000177174 GAGTATGACATAATGTGCAAA pLKO.1 706 CDS 100% 4.950 3.960 N Ola1 n/a
3 TRCN0000320281 GAGTATGACATAATGTGCAAA pLKO_005 706 CDS 100% 4.950 3.960 N Ola1 n/a
4 TRCN0000216165 CTACCTTCTTCAATGTATTAA pLKO.1 269 CDS 100% 15.000 10.500 N Ola1 n/a
5 TRCN0000177940 GCTTTCCTAAATGTAGTGGAT pLKO.1 418 CDS 100% 2.640 1.848 N Ola1 n/a
6 TRCN0000320292 GCTTTCCTAAATGTAGTGGAT pLKO_005 418 CDS 100% 2.640 1.848 N Ola1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11904 pDONR223 100% 82.4% 86.4% None (many diffs) n/a
2 ccsbBroad304_11904 pLX_304 0% 82.4% 86.4% V5 (many diffs) n/a
3 TRCN0000473397 ACCCTAGTATATAAACATGTTCAT pLX_317 51.5% 82.4% 86.4% V5 (many diffs) n/a
4 ccsbBroadEn_08121 pDONR223 100% 59.7% 62.4% None (many diffs) n/a
5 ccsbBroad304_08121 pLX_304 0% 59.7% 62.4% V5 (many diffs) n/a
6 TRCN0000472614 ACACTGTTAGCTCGTCCACATCGT pLX_317 38% 59.7% 62.4% V5 (many diffs) n/a
Download CSV