Transcript: Mouse NM_030228.3

Mus musculus growth arrest-specific 2 like 1 (Gas2l1), transcript variant alpha, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gas2l1 (78926)
Length:
3986
CDS:
392..1426

Additional Resources:

NCBI RefSeq record:
NM_030228.3
NBCI Gene record:
Gas2l1 (78926)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247529 TGCCTGAAGTGCTCATGTTTG pLKO_005 738 CDS 100% 10.800 15.120 N Gas2l1 n/a
2 TRCN0000247527 ACGCCCAATGACCTTCGAAAC pLKO_005 992 CDS 100% 6.000 8.400 N Gas2l1 n/a
3 TRCN0000247528 GACCAGTTTCCCATGATCAAG pLKO_005 1058 CDS 100% 4.950 3.465 N Gas2l1 n/a
4 TRCN0000198525 GCTGAAGAGGATGTCACTGAA pLKO.1 929 CDS 100% 4.950 3.465 N Gas2l1 n/a
5 TRCN0000247526 GGCCGATTGGCTCAATGCTTT pLKO_005 490 CDS 100% 4.950 3.465 N Gas2l1 n/a
6 TRCN0000181663 GCTCATGTTTGAGACAGAGGA pLKO.1 748 CDS 100% 2.640 1.584 N Gas2l1 n/a
7 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 272 5UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07659 pDONR223 100% 41.7% 43.6% None (many diffs) n/a
2 ccsbBroad304_07659 pLX_304 0% 41.7% 43.6% V5 (many diffs) n/a
3 ccsbBroadEn_07658 pDONR223 100% 41.7% 43.6% None (many diffs) n/a
4 ccsbBroad304_07658 pLX_304 0% 41.7% 43.6% V5 (many diffs) n/a
5 TRCN0000480521 AAGGACGGTTGATCGAGCTACATC pLX_317 19.9% 41.7% 43.6% V5 (many diffs) n/a
Download CSV