Transcript: Human NM_030613.4

Homo sapiens ZFP2 zinc finger protein (ZFP2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZFP2 (80108)
Length:
2410
CDS:
512..1897

Additional Resources:

NCBI RefSeq record:
NM_030613.4
NBCI Gene record:
ZFP2 (80108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030613.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412255 CCAAGTGGGAGTTACCCATAA pLKO_005 601 CDS 100% 10.800 15.120 N ZFP2 n/a
2 TRCN0000436538 TGAGAGTATGTGGAGGTAATG pLKO_005 639 CDS 100% 10.800 15.120 N ZFP2 n/a
3 TRCN0000017596 CGGAGTACAAACCTTACACGA pLKO.1 1856 CDS 100% 2.640 3.696 N ZFP2 n/a
4 TRCN0000415358 GAAACCTGGGAACCTAATAAT pLKO_005 548 CDS 100% 15.000 10.500 N ZFP2 n/a
5 TRCN0000425565 CAGTCAAAGCATGCATCTTAT pLKO_005 1264 CDS 100% 13.200 9.240 N ZFP2 n/a
6 TRCN0000017593 GCCTTTAGTCAGAGCATGAAT pLKO.1 1007 CDS 100% 5.625 3.938 N ZFP2 n/a
7 TRCN0000017595 CAAAGCATGAATTTGACAGTT pLKO.1 1184 CDS 100% 4.950 3.465 N ZFP2 n/a
8 TRCN0000017594 GCTTACCTTATTGAACATCAA pLKO.1 1694 CDS 100% 4.950 3.465 N ZFP2 n/a
9 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 968 CDS 100% 15.000 7.500 Y ZNF443 n/a
10 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 968 CDS 100% 15.000 7.500 Y Zfp97 n/a
11 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1137 CDS 100% 13.200 6.600 Y Zfp934 n/a
12 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1137 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
13 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1137 CDS 100% 13.200 6.600 Y EG668616 n/a
14 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 1807 CDS 100% 13.200 6.600 Y Gm14305 n/a
15 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1806 CDS 100% 10.800 5.400 Y Gm14308 n/a
16 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1557 CDS 100% 5.625 2.813 Y ZNF345 n/a
17 TRCN0000239754 GAGAAACCTTATGAGTGTAAT pLKO_005 1562 CDS 100% 13.200 6.600 Y Gm11677 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030613.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09001 pDONR223 100% 99.9% 100% None 822A>G n/a
2 ccsbBroad304_09001 pLX_304 0% 99.9% 100% V5 822A>G n/a
3 TRCN0000481633 CCAAATCACGATATTTTGAGTATA pLX_317 26.4% 99.9% 100% V5 822A>G n/a
4 ccsbBroadEn_15999 pDONR223 0% 99.8% 100% None 636A>G;822A>G n/a
5 ccsbBroad304_15999 pLX_304 0% 99.8% 100% V5 636A>G;822A>G n/a
6 TRCN0000480436 GGTCATGTTAAACACTTAGCTGTT pLX_317 26.8% 99.8% 100% V5 636A>G;822A>G n/a
7 ccsbBroadEn_09000 pDONR223 100% 99.8% 100% None 636A>G;822A>G n/a
8 ccsbBroad304_09000 pLX_304 0% 99.8% 100% V5 636A>G;822A>G n/a
9 TRCN0000476627 GCCCTTAGCGCATCTCGCCCTTGA pLX_317 23.8% 99.8% 100% V5 636A>G;822A>G n/a
Download CSV