Transcript: Human NM_030648.3

Homo sapiens SET domain containing 7, histone lysine methyltransferase (SETD7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SETD7 (80854)
Length:
7374
CDS:
633..1733

Additional Resources:

NCBI RefSeq record:
NM_030648.3
NBCI Gene record:
SETD7 (80854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030648.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358985 GATCTATGCACTACGTTTATC pLKO_005 1776 3UTR 100% 13.200 18.480 N SETD7 n/a
2 TRCN0000078632 GCCCTATAACCACGTATCCAA pLKO.1 1469 CDS 100% 3.000 4.200 N SETD7 n/a
3 TRCN0000358986 CATGGAGTGTGCTGGATATAT pLKO_005 978 CDS 100% 15.000 10.500 N SETD7 n/a
4 TRCN0000078629 CCGCACTTTATGGGAAATTTA pLKO.1 1090 CDS 100% 15.000 10.500 N SETD7 n/a
5 TRCN0000368642 GGTAGCTGTGGGACCTAATAC pLKO_005 1331 CDS 100% 13.200 9.240 N SETD7 n/a
6 TRCN0000078630 CCAGATCCTTATGAATCAGAA pLKO.1 1254 CDS 100% 4.950 3.465 N SETD7 n/a
7 TRCN0000078631 CTTATGAATCAGAAAGGGTTT pLKO.1 1261 CDS 100% 4.050 2.835 N SETD7 n/a
8 TRCN0000078628 GCCAGGGTATTATTATAGAAT pLKO.1 2440 3UTR 100% 5.625 3.375 N SETD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030648.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04227 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04227 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474642 TCTTCTGGATACGAGTGATTTGTT pLX_317 17.5% 100% 100% V5 n/a
Download CSV