Transcript: Mouse NM_030678.3

Mus musculus glycogen synthase 1, muscle (Gys1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gys1 (14936)
Length:
3681
CDS:
215..2431

Additional Resources:

NCBI RefSeq record:
NM_030678.3
NBCI Gene record:
Gys1 (14936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075793 GCTTCTTCGTTTGATCCTATA pLKO.1 2772 3UTR 100% 10.800 8.640 N Gys1 n/a
2 TRCN0000075780 GCAAGGGTTGTAAGGTGTATT pLKO.1 501 CDS 100% 13.200 9.240 N Gys1 n/a
3 TRCN0000075778 GCGGTGATACACATCTGTAAT pLKO.1 3011 3UTR 100% 13.200 9.240 N Gys1 n/a
4 TRCN0000075781 CCAGACCACTTCACCTATGAA pLKO.1 2066 CDS 100% 5.625 3.938 N Gys1 n/a
5 TRCN0000075795 CCTGGACTTCAACCTAGACAA pLKO.1 1159 CDS 100% 4.950 3.465 N Gys1 n/a
6 TRCN0000075779 GCCAATACAGTCAAGGAGAAA pLKO.1 1391 CDS 100% 4.950 3.465 N Gys1 n/a
7 TRCN0000075797 CAGCAAGGGTTGTAAGGTGTA pLKO.1 499 CDS 100% 4.050 2.835 N Gys1 n/a
8 TRCN0000075782 CCCATGTCTTCACTACCGTAT pLKO.1 969 CDS 100% 4.050 2.835 N Gys1 n/a
9 TRCN0000075794 CCGGACCAATAATTTCAACGT pLKO.1 1324 CDS 100% 2.640 1.848 N Gys1 n/a
10 TRCN0000075796 GCCCATGTCTTCACTACCGTA pLKO.1 968 CDS 100% 2.640 1.848 N Gys1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489858 ATACCTGAGCCCACGATTAAGAAC pLX_317 16% 87.3% 96.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15439 pDONR223 0% 79.6% 87.9% None (many diffs) n/a
3 ccsbBroad304_15439 pLX_304 0% 79.6% 87.9% V5 (many diffs) n/a
4 TRCN0000467641 ATCCATCCTGTTACCCCTACTTTA pLX_317 17.4% 79.6% 87.9% V5 (many diffs) n/a
Download CSV