Transcript: Human NM_030935.5

Homo sapiens TSC22 domain family member 4 (TSC22D4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TSC22D4 (81628)
Length:
2318
CDS:
691..1878

Additional Resources:

NCBI RefSeq record:
NM_030935.5
NBCI Gene record:
TSC22D4 (81628)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030935.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018129 CTGGACGTGTGTGGATGTTTA pLKO.1 957 CDS 100% 13.200 9.240 N TSC22D4 n/a
2 TRCN0000420004 GTGAAGTCCCACCTCATGTTT pLKO_005 1675 CDS 100% 5.625 3.938 N TSC22D4 n/a
3 TRCN0000018128 CCGGAGGAAAGCTGTAGACAT pLKO.1 1389 CDS 100% 4.950 3.465 N TSC22D4 n/a
4 TRCN0000086357 CCTGGTTGGCATTGACAACAA pLKO.1 1632 CDS 100% 4.950 3.465 N Tsc22d4 n/a
5 TRCN0000416275 GAGTTCAAGGCTCAGTAATGG pLKO_005 1982 3UTR 100% 4.950 3.465 N TSC22D4 n/a
6 TRCN0000018131 CCTGGTTCACAAATCTCCAGA pLKO.1 1512 CDS 100% 2.640 1.848 N TSC22D4 n/a
7 TRCN0000018130 CGGAGCAGTAGCAGCTCAGAA pLKO.1 1539 CDS 100% 1.650 1.155 N TSC22D4 n/a
8 TRCN0000018132 CACCAGCGTCACCACGGACTA pLKO.1 726 CDS 100% 0.000 0.000 N TSC22D4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030935.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16011 pDONR223 0% 100% 100% None n/a
2 TRCN0000470943 CCCGACATCTAGCCTCCTAAAGAT pLX_317 42% 100% 100% V5 n/a
3 ccsbBroadEn_16012 pDONR223 0% 99.9% 100% None 1051T>C n/a
4 ccsbBroad304_16012 pLX_304 0% 99.9% 100% V5 1051T>C n/a
5 TRCN0000471474 CTGAAGCACGCGATAGCGACTGAG pLX_317 40.9% 99.9% 100% V5 1051T>C n/a
6 ccsbBroadEn_04251 pDONR223 100% 99.8% 100% None 795A>G;1051T>C n/a
7 ccsbBroad304_04251 pLX_304 0% 99.8% 100% V5 795A>G;1051T>C n/a
8 TRCN0000467188 TTTAGCGAGAGCCCCCGCGACACC pLX_317 36.3% 99.8% 100% V5 795A>G;1051T>C n/a
Download CSV