Transcript: Human NM_030952.3

Homo sapiens NUAK family kinase 2 (NUAK2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
NUAK2 (81788)
Length:
3391
CDS:
118..2004

Additional Resources:

NCBI RefSeq record:
NM_030952.3
NBCI Gene record:
NUAK2 (81788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144927 AAGATCTGATGCACATACGG pXPR_003 AGG 291 15% 2 0.6124 NUAK2 NUAK2 77001
2 BRDN0001145484 TATTCCCATTGGCATCCAAG pXPR_003 AGG 548 29% 4 0.4646 NUAK2 NUAK2 77000
3 BRDN0001147522 CTGGGGCTACGCCACCCGAG pXPR_003 TGG 928 49% 7 -0.1980 NUAK2 NUAK2 77003
4 BRDN0001146174 TGTCATCAGCCGTGTCACTG pXPR_003 TGG 1166 62% 7 -0.3537 NUAK2 NUAK2 77002
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030952.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196533 GACTCTAGAATGTCCATATTT pLKO.1 3116 3UTR 100% 15.000 21.000 N NUAK2 n/a
2 TRCN0000231542 TGGAGTAACGCTTCGTTATTT pLKO_005 2508 3UTR 100% 15.000 21.000 N NUAK2 n/a
3 TRCN0000231540 ACCATAAGATCCTAGTGAAAC pLKO_005 878 CDS 100% 10.800 15.120 N NUAK2 n/a
4 TRCN0000231541 ATCGCAAAGGCATCCTCAAAC pLKO_005 1607 CDS 100% 10.800 15.120 N NUAK2 n/a
5 TRCN0000231539 TGAGCGCGAAGCTAGGCATTT pLKO_005 561 CDS 100% 10.800 15.120 N NUAK2 n/a
6 TRCN0000003206 GCTGAACGAAGAGGATACTAA pLKO.1 2209 3UTR 100% 5.625 7.875 N NUAK2 n/a
7 TRCN0000195372 CATCGCAAAGGCATCCTCAAA pLKO.1 1606 CDS 100% 4.950 6.930 N NUAK2 n/a
8 TRCN0000199900 GCGCCAGCATTCGCTCAAGAA pLKO.1 1224 CDS 100% 1.650 2.310 N NUAK2 n/a
9 TRCN0000381286 GGATATGGGAAGTAGGCAAAT pLKO_005 2151 3UTR 100% 10.800 7.560 N NUAK2 n/a
10 TRCN0000197284 GTACACATGGTGCCTTCTAAG pLKO.1 2356 3UTR 100% 10.800 7.560 N NUAK2 n/a
11 TRCN0000231538 TCAACCACCCTCACATCATTG pLKO_005 437 CDS 100% 10.800 7.560 N NUAK2 n/a
12 TRCN0000194664 CCATGAATACTCTGTACACAT pLKO.1 2343 3UTR 100% 4.950 3.465 N NUAK2 n/a
13 TRCN0000195483 CGTGCACTATTGCCATCAGAA pLKO.1 603 CDS 100% 4.950 3.465 N NUAK2 n/a
14 TRCN0000003207 CTCTCCAACCTCTACCATCAA pLKO.1 703 CDS 100% 4.950 3.465 N NUAK2 n/a
15 TRCN0000003205 GACCATAAGATCCTAGTGAAA pLKO.1 877 CDS 100% 4.950 3.465 N NUAK2 n/a
16 TRCN0000199479 GCACTGAGGGTCTGCTCAAAG pLKO.1 1975 CDS 100% 3.600 2.520 N NUAK2 n/a
17 TRCN0000003208 CCCTCACATCATTGCCATCCA pLKO.1 444 CDS 100% 2.640 1.848 N NUAK2 n/a
18 TRCN0000010767 CCGGTGGCTGTTGATGGTGAA pLKO.1 957 CDS 100% 1.350 0.945 N NUAK2 n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2802 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2802 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030952.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09084 pDONR223 100% 99.9% 100% None 585T>C n/a
2 ccsbBroad304_09084 pLX_304 0% 99.9% 100% V5 585T>C n/a
3 TRCN0000480236 GTCTCTATGCAATAGGTCCACTGT pLX_317 17.5% 99.9% 100% V5 585T>C n/a
4 ccsbBroadEn_15176 pDONR223 0% 99.9% 100% None 585T>C n/a
5 ccsbBroad304_15176 pLX_304 0% 99.9% 100% V5 585T>C n/a
6 TRCN0000470541 TATAGAGTAGCGGTCTTGGTCACC pLX_317 17.5% 99.9% 100% V5 585T>C n/a
7 TRCN0000488325 TTAGGGTACAACCTATTAATGCGC pLX_317 17.6% 99.9% 100% V5 (not translated due to prior stop codon) 585T>C n/a
Download CSV