Transcript: Mouse NM_031169.4

Mus musculus potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Kcnmb1 (16533)
Length:
4188
CDS:
339..914

Additional Resources:

NCBI RefSeq record:
NM_031169.4
NBCI Gene record:
Kcnmb1 (16533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031169.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068366 CGGAAGACACTCGGGATCAAA pLKO.1 616 CDS 100% 5.625 7.875 N Kcnmb1 n/a
2 TRCN0000068364 CCATGCCTTTGGGTCAATGTA pLKO.1 561 CDS 100% 5.625 4.500 N Kcnmb1 n/a
3 TRCN0000068367 TGAAGCTCAACAGGTCCCTAT pLKO.1 871 CDS 100% 4.050 3.240 N Kcnmb1 n/a
4 TRCN0000068363 GCCAATTTCTATAAGCACCAT pLKO.1 711 CDS 100% 2.640 1.848 N Kcnmb1 n/a
5 TRCN0000068365 CCAGGAATCCATATGTCACTT pLKO.1 482 CDS 100% 0.000 0.000 N Kcnmb1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4023 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031169.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13886 pDONR223 100% 54.5% 44.1% None (many diffs) n/a
2 ccsbBroad304_13886 pLX_304 0% 54.5% 44.1% V5 (many diffs) n/a
3 TRCN0000480872 TTGTGGGAATCAAATTGGTGGATC pLX_317 100% 54.5% 44.1% V5 (many diffs) n/a
Download CSV