Transcript: Human NM_031268.6

Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PDPK1 (5170)
Length:
6803
CDS:
93..1382

Additional Resources:

NCBI RefSeq record:
NM_031268.6
NBCI Gene record:
PDPK1 (5170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162206 GTTCTTCGAGTCCGTCACGT pXPR_003 GGG 655 51% 7 0.0592 PDPK1, PDPK2P PDPK1 77451
2 BRDN0001162582 CAAGTTTGGGAAAATCCTTG pXPR_003 GGG 262 20% 2 0.0474 PDPK1 PDPK1 77450
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031268.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221540 CCTTGGCACCAGTTTGTAGAA pLKO.1 1050 CDS 100% 4.950 6.930 N PDPK1 n/a
2 TRCN0000234794 ACGCCTAACAGGACGTATTAT pLKO_005 1263 CDS 100% 15.000 19.500 N PDPK1 n/a
3 TRCN0000010414 GATAAGCGGAAGGGTTTATTT pLKO.1 1101 CDS 100% 15.000 10.500 N PDPK1 n/a
4 TRCN0000234792 GGATAAGCGGAAGGGTTTATT pLKO_005 1100 CDS 100% 15.000 10.500 N PDPK1 n/a
5 TRCN0000234795 TATAGACTCAGAAGGTATATT pLKO_005 5199 3UTR 100% 15.000 10.500 N PDPK1 n/a
6 TRCN0000238781 AGGACTGCTATGGCAATTATG pLKO_005 820 CDS 100% 13.200 9.240 N PDPK1 n/a
7 TRCN0000221541 CAAAGTTCTGAAAGGTGAAAT pLKO.1 1184 CDS 100% 13.200 9.240 N PDPK1 n/a
8 TRCN0000001480 TCGACCAGAGGCCAAGAATTT pLKO.1 1223 CDS 100% 13.200 9.240 N PDPK1 n/a
9 TRCN0000234793 TCGACCAGAGGCCAAGAATTT pLKO_005 1223 CDS 100% 13.200 9.240 N PDPK1 n/a
10 TRCN0000196433 GAAGGTATATTAGGACATTTG pLKO.1 5209 3UTR 100% 10.800 7.560 N PDPK1 n/a
11 TRCN0000010413 CAACATAGAGCAGTACATTCA pLKO.1 941 CDS 100% 4.950 3.465 N PDPK1 n/a
12 TRCN0000221539 CGAAGATGAGAAGAGGTTGTT pLKO.1 1004 CDS 100% 4.950 3.465 N PDPK1 n/a
13 TRCN0000001476 GCAGCAACATAGAGCAGTACA pLKO.1 937 CDS 100% 4.950 3.465 N PDPK1 n/a
14 TRCN0000001478 AGTGGATAAGCGGAAGGGTTT pLKO.1 1097 CDS 100% 4.050 2.835 N PDPK1 n/a
15 TRCN0000001479 CGGAAGGGTTTATTTGCAAGA pLKO.1 1107 CDS 100% 4.050 2.835 N PDPK1 n/a
16 TRCN0000195195 CAGAAGATCATTAAGTTGGAA pLKO.1 585 CDS 100% 3.000 2.100 N PDPK2P n/a
17 TRCN0000001477 TCACAGAAGGACCACATTTAT pLKO.1 1144 CDS 100% 15.000 9.000 N PDPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031268.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01168 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01168 pLX_304 31.2% 99.5% 99.3% V5 (many diffs) n/a
3 ccsbBroadEn_14741 pDONR223 0% 100% 100% None n/a
4 ccsbBroad304_14741 pLX_304 41.3% 100% 100% V5 n/a
5 TRCN0000480980 CAGTAGTGACAATACTGCTATGTA pLX_317 36% 100% 100% V5 n/a
6 TRCN0000487873 CCTTACGAGACCCGGGACGTAGGT pLX_317 17.3% 77.1% 76.9% V5 (not translated due to prior stop codon) 328_329ins381 n/a
7 TRCN0000487875 ACAAACAGTCCTGGGTGGCTTGGC pLX_317 19.2% 77.1% 76.8% V5 328_329ins381;1287_1288insG n/a
Download CSV